Gene detail

Detailed information of OS493_015519-T1 in Lophelia pertusa

Genomic Location: scaffold_47:169826...185468
NR annotation: KAJ7360419.1, Protein fantom [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015519-T1

ATGCCAGTTTCTTCAGTCATGGACGGACCCTCGTTCTCCATAGCTGAAGATGGAGATGGAAGAGCATTTAGTGAAATTTATGCTCGCCAGTTAATCTCTAAGATAAGTAGAGAGGAACTTGAAGACAAATATTTGAGGCTTCAGGAAGATAACCAGGAATTGAAGAAGTATGCAAGAAAACAGGAGGAGAAGATCAAAAAGATGGCAACCAAACTGCTTCGATTGGTCCACGACAAGAAGAGGGAGGCTGCAGAAGGAATTTCTGCTGTAAAAGACGTGGACACAAAGGAGAAAATAGCAGATATGGAAACTAAAATTGTAGAACTAGAAAAACAGAATGCTGGATTAAAAAATAAGCTTACAGTTGCTAGGCAACAGCTTCAGACTCAAGGAAAGCGTGCAACCCCTTATGACCATGTGAAACCTCGAGTTCAAACAGGTATCCATGCCAGATCTCCATCTGGAAACCGACTCAAAAAGGATTTGAGAGTTCAGGGTCATGACATCAAGCCTGGATCTGCAAGACTTCCACCTCCACTGTTACCTCAACCAAGATATGGGCACAGTCTACTTGAGGAGGCCAGGCTCGAAAAGAGGGAGCTGGAAGAGTTCATTTCTCAACTTCAAGATCAAATTCAGTTACTGGACGAGGATGGAGTTCAATTAAGGGATCAGATGAGGCAAAACCAACTTCGCCACGAAGATGAGATCATGAGATTGAAAGAGCAGTTATCTGATGCACAAAGATCCAATATCCAGGAAAATGTAGACTTGATCAGACTTCAGAGGGAGATGAAGGAAAAAGCGACAAAGTTTGAAGCTCTGCAGGTCAAATATTTCAATCTAGAAGAGAATCTCGCCAAAGTCAAAGCAAGTCACACACAAGTGCTTGACGACATGGAAACACTCAGAGAGGAACTAAAACAGGAACAAACAAAGAATTATGTGTTGAAAAATGACCTGAAGAGTGGAGGAATAGCATCAAAATCTCTGTCAGAGCAACTTCAAATGATAGGAGATCTGAAAGCAGAGAATGCGATCTTAAAGGAAGCCAATGAAAATTTAGTGAACAGCTCAAAACTAATCCTTGAGGAATTTTCGACTGTACACTTATCAGGAGAAATGAAAGGGAGAGACAACACAGGGCGAAGTACAGACACATGGAGGTGGAGATGGAGCAGTTACGAGCTACTTTGCATTCAGACTTACAAGAGAAAAAATGACATTCTTGACAAATTAACAAACGAAAGAGAATCTGCAGAAAAGCTTCATTCAGAGCTGCGTGAATTGAGAGTCCAACATTACACACTGAAAGAACAACATGATGACTTGAAGGAGAAGATGAAATTTTTCACCAAGGAAAGTGCAGTAGATTTCCAGGAAATCGAAGAGGCCCTTGTCTTGATCAAACATAGGAAAGAAAAAGGCAGTCAGGACTTGGATTTCTTGGAAAAGGTTGATGACGAAAAGAGTAAAGATCTGAAACGACAAGTACAAGAATTACATGCATCGCATGCGGATACCATCAACGAGCTGGAGAAAACAAGAAACATGTTAATAATCCAACACAAGATTAACAAAGATTACCAGACAGAGGTTGAACGTGTCACAAAGAAAATGAGTGAAGATAAAAAGGAATATGACCTGAAGATGCAAGAGTACGCACAACTACTGGACATTAGAGCTGATAGAATACGAAAACTTGAAAGTCAGATGCGAGACATTGCTTATGGAACCAAACAGTACAAAGCTCCCGCGTCAGAGCAGGAGTCCGAGTTTGAAGAAATGGATAGTACAGTTGAGCTGGAACGAGGGCAAAATATCTTTGAAATTCACATTGATAAGGTCATCTTCTCACAAGAAGCCATCAAAGAGTTTGAGGATGGCGAACCCGTCACGTTTGTGACGTATGAGTTCTTTGAACACGAGCTTCAAACCACGCCTGTTGTCAAGGGAACCAGACCCGAGTTCAATTTTACTTCGCAGTATCTAGTGAGAGTTGACGATTTCTTCCTGCATTACTTGCAAAAGGAGTCCACGTTAATAGAGATCCATCGAGCATTTGGTACTGACTACAAGACTGTAGCAGCTTGTCAGCTGAAGTTTAGAGACCTGCTTGAGAAACCTCATGGGAGAGTTCACAGCACTGCCAAGCTCATAGGTTCCAGGCCCCCGTGTCAAGGAGTAGAGTTTGCAACTATGGAGTACTGGGAGCGTACCAAGGCTCTTGGTTACATGAACTCTGGAGCATACAAAGCCCTTGAAGATGCTGGTCACGTGACAGAGAAACCGCCTTCTGATGTCAATGAAGTGGACGTGCATATCATCAGATGTAGTGGCGTTAAACCCAGAAGACAAGGAATACAGCCGAGTCCATACGTGGTGTACCGTTTCTTTGACTTTGCTGATCACGATACAGATATCGTACAGAGCACCAACACACCCGAGTTTAATGACATCAAGACATTCCCTGTACCTATGACACCTGAACTGGATACTTATCTCAGAGCCGCGGCGTTGGAGATGTATGTATTTGATGATGCTGATCCAGAGCCTGCAGCATACCTGGGACTCGCTAGAGTACCGCTAATAACACTAGCTAATGACAAGGTCATCAAGGGAACCTTTGAACTACGGAAGGCCTCGGGAGGCGTGAATGGAACAATTGATGTTTACTTGAAATGGAGATACACGTATCTTCCAGCTAGTGCCAAGCCCCGCGCAGCTCCTCAGCGAGTAATGCAAGTCCCTGACGACAGGGAGCCGTTCAGCTCTGATAGTGAACCGGAATTCAAAGCGGCCGTCAAATCGCCGAAAAAGAGAGAGAAACCTCCGTCTCCTGTTGACTCATCGACTCCTAAACAGGAACAGCGTGAAGAAAAGATTGCCAGACGAGAGTCGACTCATCTGGCGCAGATAAAACGGAAACCATCGGATCTGATAGAGAAGGTTGAGCCCAGAGTGACTGAGAGGAAAAAACCAAAGCCACCGGAGCCAATGACAGTGGATGAGTTGGTAGAGTCAACAATAGAGAAACCCCAGCCTGCCCCGCGCACCCGTAAACTTGAACCTGAGAAGCCTGAGGAGATGTCTATTGACGAGATGATCAAAGCGGCCGATGAGCCGACAGAGGAGCCTGGGAGCGAGGTGAAGTCTACTGGGGAAATCATTGAGACGTCCGAAGATGAACAGAATGACGAGGCTCTTGTAGCTGAAGAGATGAGACGGACCACTGAGGCAGCAGTCAGCGACGACACCATGTTTGAGGATCCAACGTCAGATTTTGACTCGACGCTCGGTGAGGAAGTGGACATACCTCTTCCCGCGGCCGAGTCCAAGGAAGGACTGGATGAAGAAGAAGAAGAATCAGCAGAAGAAGTGGAGGAGGAGATAGATGAAGAGATAGCCGAAGATGAAGAGGAGGAGGAGGAGGAGGCGGAGGATGAACGAGAACAGGAAAAAGGAGACGGTCCTGGTGAAAGTGGAGCTGAAACAAGCGAGAGTGAAGCTGTGGTGGTTTCTCCGAGACATTCTCGCGCCAAATCTGCTGTGCCGGTACGTTTTACTAGAATTACTATTTGA

Transcript

OS493_015519-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q68CZ1	Protein fantom OS=Homo sapiens OX=9606 GN=RPGRIP1L PE=1 SV=2
Q8CG73	Protein fantom OS=Mus musculus OX=10090 GN=Rpgrip1l PE=1 SV=2
Q9GLM3	X-linked retinitis pigmentosa GTPase regulator-interacting protein 1 OS=Bos taurus OX=9913 GN=RPGRIP1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003431 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00168 all species →	C2	C2 domain	Domain	Interproscan
PF11618 all species →	C2-C2_1	First C2 domain of RPGR-interacting protein 1	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR021656 all species →	Domain	RPGR-interacting protein 1, first C2 domain	Interproscan
IPR031139 all species →	Family	RPGRIP1 family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14240 all species →	RETINITIS PIGMENTOSA GTPASE REGULATOR-INTERACTING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0035869 all species →	Cellular Component	ciliary transition zone	Interproscan
GO:1905515 all species →	Biological Process	non-motile cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16550	RPGRIP1L; protein fantom	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015519-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

43.8Max TPM

14.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.40	22.79
polyp at pH7 6	18	18	16.44	22.99
coral polyp · control treatment	16	16	17.57	43.77
coral polyp · oil and dispersant treatment	16	16	13.17	39.89
coral polyp · oil treatment	16	16	15.97	22.96
coral polyp · dispersant treatment	16	16	8.73	18.07
Polyp	10	9	8.90	14.87

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.79
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.38
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.16
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.76
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.23
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.04
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.46
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.04
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.18
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.00
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.70
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.50
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.17
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.76
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.71
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.12
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.68
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.46
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.99
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.44
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.68
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.82
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.74
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.41
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.26
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.75
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.64
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.45
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.18
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.10
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.89
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.45
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.87
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.76
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.89
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.72
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.61
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.80
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.45
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.01
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.25
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.17
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.98
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.67
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.70
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.96
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.73
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.40
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.98
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.96
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.89
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.67
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.71
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.71
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.35
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.31
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.21
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.19
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.15
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.13
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.17
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.69
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.43
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.07
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.60
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.96
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.11
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.95
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.15
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.32
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.92
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.50
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.46
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.18
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.13
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.81
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.15
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.86
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.58
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.22
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.20
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.07
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.38
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.88
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.67
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.11
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.06
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.56
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.16
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.90
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.96
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.90
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.66
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.23
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.23
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.86
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.08
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.87
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.50
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.08
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.07
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.61
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.55
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.54
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.03
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.