Gene detail

Detailed information of OS493_015531-T1 in Lophelia pertusa

Genomic Location: scaffold_47:282715...300354
NR annotation: KAJ7360430.1, hypothetical protein OS493_015531 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015531-T1

ATGCAGACTTTGGACGTTTACAAGAAGGAAGAAGGAAAGATTTGGCAGCGGAAACCATCTCCTTCACCGGAGGAAGGTTTGATAGTATGTGTTAGTCATTCCACGTCAAGTGCATTCTCATTACAAGGAAGGAATATCAGATTCCTTCGGACGGCATTTAATACAACTGGTGAAGCCTTTGCAGCCGGTGATCACCAAGGAAACATTTTCGTCTTCGATTTAGCTAAGAACAGGTTCTCATTAATCCACAAAACAGGAACTCCATGCACTGCCATTTCTTTCTGTCTGCGGAGAAAAAATGAAGTGTTGGTGGCTCTTGCAGACAACTCTCTGAGATGTTATGATACAGAATCGCATGAGTTAGTAAGCTGGATGAGAGGCAATGACTCGTCAATTCACAGCATATCAGTTCATGCTTCAGGACGTTATGCGCTGACATCATCCAACTCTGTAGCTCAGTTATGGGATCTTGATACATTTTCTCGCAAAAGGACATTAAATGGAGCTCAGACTGTAGGAATACAGCAGGTTCTTTATTTACCACTGAGCAATACCATAGTAACATGTTTCAAAGACGACAGCTTGTTTGTATGGGATTCAGAAACACTCAAGTGTAAATTTCAGTTACCTGTGCCACCTGAAGAGGCTAAACAGTCCCACTACAGGGCTTTAGCCACGCCGAGGGATGGTCGGTTGCTTGTAGCTGGAGGAAGGTCTCGTTTTCTTCATGTATGGAGTCTGGAGAATAAGCGTTTGCTTCATGTTATTCAGCTTCCTGCAAGAGTGCGACTTGTCAGGCAATTAGATTTTATTAGTAACAGCTTTGATGGTGGGACCAGTCAGACCCTAGCTGTATTGTCTCAAGATGGCATTCTGCGTTTTATTGACATCCATGCTTGTAAGCAGCTGTTTGAGATTGGAGGTGCTGATGAGATGATAAACAACTTCAGCATAAGTTCAAATGGCCGATATGTCGCAGCTGTAATGGACAATGGTAACATCAATGTTTACAGTGTCCCTGCACTGTCACAACATTTTACCAAGCCACCTCCGCCATTGGTTAAAACTGTGTGGGAGGAGAGACCACTGTCCCGACAAGGCGGCAAATCAGGACAGTCACTTGCAAGTGCCATGACTAAAGTTGGAGGAACACCAAAAAGGAACAAGACCAAATCACCAGCAAGATCACGTCAGAATGCTGATGTGTCTGCGTCTTGGACTAGTCCAGACTCTGGACTTGAGAGTGAACTGCCAGAAGGCCTCAATCAAGCAAGACTCAAGTCAATTCTTCAAGGCTATGGCGAATATCCTGCTAAATACAGAATGTTTATTTGGCGGTCACTTCTCAAACTTCCTGAGAACCATGCAGCTTACAGCAGCTTGGTGGACAAAGGAACTCACAATGCTTTTGCGAGACTCCATGAAGAATATCCAATAAAAAGTAGAAAACTCTTGAGAGTCCTTCAGAGATCGTTGTCAGCTCTAGCCCACTGGTCAGCCATATTTGGTGAAGTAGATTACCTGGCGCTTCTGTCGTTTCCTTTTGTTAAACTGTTCCAGAACAATCAGTTGATTTGTTTTGAGATGATAGCAACAATCCTGATAAACTGGTGTCAACATTGGTTTGAATTTTTTCCCAACCCTCCTGTGAATATTCTTGGTATGGTGGAGAATGTGCTAGTACATCATGACAAGAGACTGATGCAGCATTTTGTCAGCTGTAATGTCACATCACAGATGTACGCCTGGCCATTGATACAGACGTTGTTATCTGAAGTGCTAACCAAAGACGAGTGGCTCAGGGCCTGGGATAACATTTTTTCCAATCATCCTTCATTCCTTCTTTTTGTCGTGGTCGCCTACGTCATTGTGTCACGCAAGGTTCTGCTGCAGTGCACAAGGAAAGAGGACTTTGAGTACTTCTTTCATAACCGGAATGCGGTGGAGGTTGGTACGGTGATTCGTGAGGCTTATCGTTTACAGGACAGCACTCCAGCAGAGGTGAACCCCAAGAGGATGCTGGAACCGTTCATTCCACTGACGAGAGGACAGTACCCCATCTTCAATAAATACCCCAAGTTTATTGTGGATTATCAGGTCCAAGAGAGGGAGCGTATTCGGCAGGATGAAGTGGAATATTTAAGACAAAGACAACTGGCCCAGGAGATGAAGGAAGTAGCATCTCAGCGGCAGCAAGAAGAGGAAGCATTCTACCGACAGCAGGAGCTCATGGTAGACGCTGAGAATCAGAGGAGAAGGATGATTGGCCAAGAAGAACAGAAACTGGGCGATCAGAGAAGCAGATTGCAGGCAATGAAACGAGAAATTCACCTGCGAGAGCTGCAACTGCTGGACGCTGTTCGCAGGCGCTTTATGCATCACCAGCAGACACTGAAAGAGACGGAGTTACAAAGACTTGATGACGAAATAGAACGCAAGGCATTGCTAAGAGAGCAAGAAACAAGACACGCCATAGAAGATGCTGAAATTAAAGGACTGGAGCTTCAAGCACAAAAAGAAATGCTTCAACAGGACTTGATCCGCGATGATCTGCAGGGTTCATTCAAGCAGCGAGCAGAACAAACGATCCAGCGTAAACAACAAGAACTAGAAGGACAGCTGTTTAGAAGAACAATGGACGCTGTGCAGGAGGTCGACATTGATTCACAAAGGATTTCTCAAGAAGAGTTAGCCAAGGCTCAACAGCAACACGCTTGTGTGAGTATGGAGGGAGAGGTAGAACTGAGGAGCAGAATGGACGATCTTCACAGGGAGTTAAATGATGTCAAGGTTGCCCAGCATGTTTTGGAGAACAAAGAAAGAGAGACCGAGATTCAGTCGCTTGTTCATGAGCTGAGGAACAAAGAGAATGATGAAGTGGCCAAGAAAGAGTCCGAGTTAAGACAACAGAAGGCTCTCGCTGCAGAAGAGGAAAGAAGACGAATGAACCTATTGAACGCTTTATCACGAGATCATACCACGACCGATGACTCCGAGTCATTCTCTCGGCTGAGGGACATTCGTCAGGTCCCGGATGAGCCCAGGAGACCGTTAAGCGCTATCCAGCCCAGTAACACGGAGAGCAGCAGCATAACAACGGACTCAAGTGGGACTCCCATCACTTCTCACGAACCGTCGCTAGAACGTCAGCGAGGAACGTTTGAGAAACGTGAACTTGAACTTATGGCGGAAGTAAGGGATCTTAGAAAGAGACTTGCTCTCAGAAGACAACAGCGTCCACCTGACTATATGGGAAATACACAACAATAA

Transcript

OS493_015531-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6DDI6	TBC1 domain family member 31 OS=Xenopus laevis OX=8355 GN=tbc1d31 PE=2 SV=1
Q6DEY8	TBC1 domain family member 31 OS=Xenopus tropicalis OX=8364 GN=tbc1d31 PE=2 SV=1
Q96DN5	TBC1 domain family member 31 OS=Homo sapiens OX=9606 GN=TBC1D31 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004127 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00566 all species →	RabGAP-TBC	Rab-GTPase-TBC domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR000195 all species →	Domain	Rab-GAP-TBC domain	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR051570 all species →	Family	TBC1 domain family involved in cilium biogenesis	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR035969 all species →	Homologous_superfamily	Rab-GAP-TBC domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19853 all species →	WD REPEAT CONTAINING PROTEIN 3 WDR3	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015531-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015531-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

31.0Max TPM

3.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.66	7.03
polyp at pH7 6	18	18	2.95	5.52
coral polyp · control treatment	16	16	5.34	28.34
coral polyp · oil and dispersant treatment	16	16	4.35	31.00
coral polyp · oil treatment	16	16	4.09	8.16
coral polyp · dispersant treatment	16	16	3.05	7.71
Polyp	10	10	2.91	5.95

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.03
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.43
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.23
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.94
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.91
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.69
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.58
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.44
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.19
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.81
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.75
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.49
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.37
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.30
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.24
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.02
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.75
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.74
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.52
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.99
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.76
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.92
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.55
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.47
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.34
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.28
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.79
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.72
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.49
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.46
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.05
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.75
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.68
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.51
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.51
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.23
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.34
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.03
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.11
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.72
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.13
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.63
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.61
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.21
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.70
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.68
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.23
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.27
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.25
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.22
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.54
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.75
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.00
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.19
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.66
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.36
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.62
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.88
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.86
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.29
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.76
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.61
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.33
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.01
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.76
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.76
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.16
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.27
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.25
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.17
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.89
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.40
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.28
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.88
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.06
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.54
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.80
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.72
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.54
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.37
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.71
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.34
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.24
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.34
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.18
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.67
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.31
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.23
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.07
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.54
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.50
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.45
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.24
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.04
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.33
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.95
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.54
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.83
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.02
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.95
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.41
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.68
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.16
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.80
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.73

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.