Gene detail

Detailed information of OS493_015557-T1 in Lophelia pertusa

Genomic Location: scaffold_47:473899...504763
NR annotation: KAJ7360456.1, riboflavin kinase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015557-T1

ATGGGACAGTACGTTGAGACTTTTGAACACAACCAGATTGATGGAGAGCTTTTCATAACAGTAGATCAGGCGATGCTAGCAGAGCTTGGATCATCTACCCGCTCACATGCAACATCAGTTGAGCAGCATCTTGCCAGCCGACGACCGCTGAGCTGCTTTGGAGCGCTTTCGCATCCACAAAGCACCACATCGCTAAAGGATTCAGCTACGACTGAAGAATTTTACAAGCAGGCACATAAGGTATTCTCAAAGACGTGGGGAGGAAAAACATACGAGAAAGTGTTTGAAGGATCAAGTTTGGTTGACAGAGTAATAGAAAAATCACCAGACAGGTATTCCACTCGAGACAAGGCGACAGAGCTTCTTCAGGGTATCCTCAAAGAAGGAATTATCAAAAGCATCGGCAGATCGAGCCTGTTCGAGGACGGTGCACAGTTGTTTTATTGGACTGAAACCTCGCACTCACCAGACAACATGGCGACCACAGCAAGAACACAGCGCTTGAACAAAACGAAACAAGAGGAAGCAAAACCAGCATGGGCAACCCCTAACTTAAAGAAAACAAGCAGGCCGGGAGGAACCTTGCCGTCTAAACGGATGGAAATTAACACTGCTACACGTGTCACTCAGAATGCAGCCGCGGCCGAAGGAGCCGCAAACAGCGACAAGAAAACGAATGCTTCTAAATCCCTGTCCAGAGGGTTAGCAGCTCTCCTTGAACGGGATCAATCATTTAGTGCTCAGAATGGTCAGGATGATAAATGTGAAGATAAGAAAGAAGAGGAGACAGAAACAAACACGCTTAACGGTGCAGTAAAAACCAGGGATGAACAAGCTAAGCCAGAAAATTCCAAACCTGAATCCAAGCACTCTTCTCCTCAGAGGATGGTGCACAAGGCTCCGCAAGCTCAACAGGTTATAACCGGTTCTGTGACTGACGATTCAAAGCCCTCTTCTACTCAGCGAATCATGCACAAGGCTCCGCAAGTTCAACAGCGAATCATGCACAAGGCTCCGCAAGTTCAACAGGTTCAAACCGGTTCTTTGACTGACGATTCCAAACACTCTTCCACTCAGCGGTTAGTGCACAAGGCTCCGCAAGTTCAACAGGTTAAAACCGGTCTTGTAACTAACATAGCAAAACCGACCCATCAAAATGGTGAAGTAGTTCCCTTGAAAAAAGCCGTACAAGAAGGAAAGGTTACTGAAGTGAAACCCGCTACTCAAACGTACGTAGCTAAGGCTCCCGTAATTGTTCAGGGAAGGAAGATTGGTCCCGAGGGCTTTCCCGAGACGAACAATGAAGATAATACCACCAAGAAGGCTGACATAATAACGCCATCTTTAAAAACATCGCCATTTATCAATCAAAAAGAAATCGAGGAAAGCGCTGCTCCTAAGGTGCTGAAAAGCTCGCCGATCAAAATGGCCAATGGTGTTCATGAGGCCAAGAAAACTGAAACTGTTACAGCTACAGAGTCATCTGCTAAGGCAATAAACGAGAATAAACACACAGACGTTGAATCGGCTGACAACGAAACAGTTGATTTCCTTAGAAAAGAAATTGAACGAATCAAGGCTGAGCATGAATTAGAGATTACTAAATTGAAACACCAATTTGAACAAGCAAAAGAGATGGCAACCTCCGAAGGAACAGCAGAGAGTGAAGCATCTTCCGACCTCTCCAGATCAAGCTCAGTGTCCAGTTTATCAGCCTCCGCGCCACCTCCGCCTCCTCCTCCGCCCGGCCCTCCCGCTCCTCCACCACCACCACCCCCTGGGTCAATGAGTCCTCCTCCACCACCTCCCCCTGTTCCTGGTGGTGGGCCGCCTCCTCCGCCTCCTCCTCCTGGCGGTCGTCGCATTGGGGGAGTACAGCCGAAGAAAGCTGCTATCAAACCCGATGTGGAAATGAAACCGTTGTTTTTGGACAAGAATTTTAATATCAGGTTAGTTTTGTGTTGCCTTAAAATTAAACATCAAGATGAGCAAGACGGTGGAGACTTAAACAACAACAAACCCATGAACACCATTTGGAAACATGTGACGGAGATGGACTTTAACAGAAAAGAATTCCAAAAGTTGTTTGGCCGCAAAACTAGCAAGAAGTCTAAGGGCGATCGCAGGAGCACCCTCAAGGATGATAGCCACTTTTCACACTCCAAAGGACAACATGCGGCCAAGTTGCTTGATAATGGACGATCTCAGACCATTGGAATCATCATGAGTAGCCTGAGTTGTCAACTGGAAGATATTAGAGACGCCATCTACAAAATGGACACCTCTGTTATCGACATGGACGGATTGAAAGCGTTATACGGAATTCGCCCAAAAGCAGATGAAATTGAACTGATTACAAAATACCAACAAGAAAACCCAAACGTCCCTCTCGACAAACCAGAGGAATTCTTACTTCAAATACATAAGATGGATCACTTTGCCGAAAGACTGGAATGCTGGTTATACAGAAACAAATTCACAGAAACCTTAACCGCCATTGACAGAAGATTATCTGCAATATGCGAGGCCAGCAGTTTACTTCGCACAAACGAGGATTTGTCATTTATTCTGTCCATAATCCTGACTCTTGGTAACTTTATGAATGGAGGAACAAACAGAGGACAGGCGGATGGATTTCAGTTGAGCGTTCTTAATAAAGTCAAAGATGTCAAAACGCAGGATAACCAAACGAATCTGATGAAATACATTGTACAAGTGTATTGTGATAAGCGGCATGGGGGCGAGCGAGGAGACTTCAATTTACCAGACCCCTACTCCATCCTCGCGGCTGCTCAGGTTTCTTTCAAGGATATCAAAGCAGAACTCGCTGAAGCTAAGATATCATTAGCAACCTGTAAAGCCAAGTCTGAGATGGTACTGGGAGGTGACAATTCAGCACACCGGGAGCCGTTTGAAAGTTTTGTGAAAGAATATTTGCAAACTGGAGAAAAGGAACTTGCTCGCTTGCAGAAAAAGGTGCAAGGAACAACGGAAGATTTCAAGGAAGTTGTAGATTATTTCCAGTACACCGGAGAAGGAGAAGAGGTGACTCCGCCACTGTTTTTCGGTATCTGGGGGAACTTCTTGGAGGTTTTCAAGAATTTTTGGAAGGCCGAACAGATTAACTTAGCCAAACGGACATTCTGCAATGCAGACCATCTCAAACAGATAAGAGCGACGGCTACCAAGTTCAAGAAACGCCGAGTCAGTGAGATAGAAGATCCCAGGATTCGAACATTGACGTCATAA

Transcript

OS493_015557-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q05858	Formin OS=Gallus gallus OX=9031 GN=LD PE=2 SV=1
Q68DA7	Formin-1 OS=Homo sapiens OX=9606 GN=FMN1 PE=1 SV=3
Q9NZ56	Formin-2 OS=Homo sapiens OX=9606 GN=FMN2 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002395 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00610 all species →	DEP	Domain found in Dishevelled, Egl-10, and Pleckstrin (DEP)	Domain	Interproscan
PF02181 all species →	FH2	Formin Homology 2 Domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR000591 all species →	Domain	DEP domain	Interproscan
IPR015425 all species →	Domain	Formin, FH2 domain	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR042201 all species →	Homologous_superfamily	Formin, FH2 domain superfamily	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45920 all species →	FORMIN HOMOLOGY 2 DOMAIN CONTAINING, ISOFORM I	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005856 all species →	Cellular Component	cytoskeleton	Interproscan
GO:0030866 all species →	Biological Process	cortical actin cytoskeleton organization	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015557-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015557-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

26.0Max TPM

7.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.41	10.24
polyp at pH7 6	18	18	6.39	9.80
coral polyp · control treatment	16	16	8.58	15.58
coral polyp · oil and dispersant treatment	16	16	6.86	14.53
coral polyp · oil treatment	16	16	9.09	25.96
coral polyp · dispersant treatment	16	16	8.49	15.32
Polyp	10	9	3.08	5.62

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.24
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.81
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.18
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.27
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.53
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.46
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.32
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.05
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.83
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.80
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.43
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.76
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.53
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.44
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.80
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.62
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.22
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.05
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.53
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.48
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.26
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.69
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.06
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.15
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.82
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.79
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.50
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.96
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.35
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.24
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.58
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.29
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.17
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.84
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.24
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.64
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.23
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.16
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.94
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.61
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.46
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.16
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.97
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.69
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.88
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.53
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.23
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.34
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.81
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.78
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.28
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.59
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.70
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.24
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.88
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.61
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.65
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.39
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.70
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.91
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.81
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.72
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.86
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.62
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.51
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.10
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.86
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.19
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.04
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.32
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.19
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.57
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.32
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.04
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.81
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.48
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.29
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.98
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.47
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.05
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.94
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.49
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.15
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.87
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.36
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.88
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.62
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.37
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.83
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.04
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.93
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.91
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.66
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.76
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.70
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.