Gene detail

Detailed information of OS493_015661-T1 in Lophelia pertusa

Genomic Location: scaffold_47:1484619...1499054
NR annotation: KAJ7360557.1, hypothetical protein OS493_015661 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015661-T1

ATGCCTCAAGGAAAGCTTCGTGGAGGAGGACTTCGCGGAGAAGTTCAATCCACTGTGCGAGAGAGTTATGGAGGCAAAGTAGTTTCGTCTAACTTCAAAAGCCGTGTTGTTCATCCAAGAAATCCTAAACTGGTCAAAGGAAGTCCTGAAGATGACAAGCAAGCACCATCTGCTTATATGGCTGAAATGCAGCTCACCACAGATGAAAGGTTAAAGCTCACATATGAGATGAGAGTGCCTCAGATTATAGAATTACTGGACATGTCAGAGCAGACACTTCAGAAGTTCACTACCATGGACATAGAGGAGCCTTTGTTCCAACCATTTCCATCTGATATTGTGTTCCAAAATTTTGACCCATTTGTGAATTACCAGGTTCCTTTACAACTAAGGAATAATGACAAGGTTGCCCGTCTGGTTAAGGTGACTCAAACTGATTCTCCATACTTCACGATCATCAGTCCACATGACATGGGACAGAAAGTAGCTCCTGGAATGGACACCACCTTCATTATCCAGTTTACTCCTGACGAGAAAAAGGACTATACCCATGAGCTTATTTGCATCACTGAAAGAGAGAAATTCCTTGTCCCAGTTAAGGCAGTTGGAGCAAGAGCTGTTCTTGATTTTCCTGACGAGATTAGCTTTGGAACATGTCCTGTCAAGTATGCCACCACAAGGACTCTTCTTGTGCGAAACATTGGCAACAATGATGCAAAGTTCCAGCTGGCAGTACAGGAACCATTCTTTGTCACACCAGAGAGTGGTCGGCTGGCTATCGGGGAGAGTATGCAGATTCATGTGGACTTTAAAGCTCTGCAGACTGGAGACCATGCTAGCCACATGATGCTTCAGTATGAAACAGGTGAAGAAATCTTTATAAGTTTGTATGGAGCTGCTATGGACTATAACATCAGGCTGGATAAAAACACAGTCAAAATGGAAAACACTTTCATATCCTGTGCTTCCCAAAGGGCAGTAACTATTTCTAACAGAAGTGACATAATTGTGCAGTTTAAGTGGACCAACTTTGCAACACTGAGGGAAGAACTGCAGCATAAAGACAGGTTTTACATGGATCTTGAAAGTGAGGAAAATGCAGAGAAAGATGAGTTCTTTGAAGAATGTCTCAGTGATCCAACTCTCAGAGATCAGATGTCAATCTTGACAAGAAAATTTAAAAACAAAATGCAGGTTGTTACTGATGACAAAATGCTCTATGCAGACTCAATAGTCACCATTGACCCAGTGGAAGGAGAGATCTGGCCAAATTCACAAGCAGAAATCAATATCGTCTTCAAACCTCAAGAAGCCCACAGTTATGCCAGAACTGTATACTGTGATGTGACAGGCAGAGAATCAAGACTGCCCTTGAGAATCAGAGGGGACGGTACAGGTCCACAAGTGCACTTCTCTTTGGATACATTAGATATTGGCAATGTGTTCATAAATTCTCAGCATTCGTATGAGGTTATTTTGTGCAACAAGGGAGATATAGATGCTGTGTTCAAACTTCTTCCTCTCAATACTCAATTTGGTCCCAGTTTTCCTTCTTTCCTGCTCAAGGAATTGTTATTCCTGGAGATTCACTTCTGCTCACCCATACTTGGTGATTTCAAAGAAGTTTTTGAGTTTGCCATTGAAGGATCACCAGAAAGACTCAAGTTAAAGATCTTGGGATCTGTCATTGGTCCAACATTCCACTTCAATATACCAAAGCTGAAATTTGGTGTAGTTTCTTATGCTGATGGGTGGGCTAGTGAGGAAACACACAGTCGTGACAGCCTGATTGATAGCAACATCAGTGATGTTGGTAGCACCATCATGCCTTCTCCAAGGGAGTTTGACATTACACCATCATCTGGTACTATAACTCCTCAAGGAGAACTGGATATAAAGGTGGACTTTGTATCAACCACTGTCAAGAAATATGAAATTGCTTTGGTAGTGGATGTGGATGGAGTTGGAGAAGAGATTCTTTCACTTCCAATAGTAGCCAACGTTTTCTTCTTCTTGACAGATGCGTTGTCCCACCCATTACTGTCTCTACACCCATCTTGGATTATGGTCGTTTGCTTTCTCCATCATCCTTACGAGTTACCTGTTCATCTGTTTAATGAGTCTGATCTGCCTGCCAAATATGAATTGCTGTCACAGGTTGTCGAGGATGTGACGCCAATCTTGTATTCTAGTCCTGAACCAAAGGGAGTTCAGATCCAGTGTGTTGGCGAGGGTCCAGTGATACATGTGACGCCAACTCATGTTGATTATGGCACCATCCCAGTCTTAACAGATGTTTCCAAGATTGTGCAGCTTTCCAATGAGTCTCTCATTCCAGCACAGTTTTCTTGCTGTATGGGTGTTATTCCTCCTGAAGATGCCTTACATCTTAAAGTCACGGCAAATGTGGATGATACAGTCAAGTTCCAGGACAAGTTGTCAATTAACATCAGTGATAGTCAGATCCAAACAGTCAGTCTTATGGCATATGGTTCTGGTACAACCATTGTAAGTGAGCCTCCTCTAGCCCCAGCTGTCAAGCTAGGTCCCCAGTTCAGCTGCCAGCCGGACAAAAAGAAGCCTGAATATAATCCAGATGACATGAGATTCCAGGGAGTGCCACCGCCTCCTGATCCGCCTAAGCCAGTCTTTCAGCTGACGCCTGACAGAATGGTTCTTCATCCTGGAGAGAGCCAAAAGTGCAGCTTGAAGGCTATTGTGAAACGTAAGCTAAACAACAAGTCTACTTGTGGATTGACAACTTTATATAGTGATGCCACCCAATGTATCCCAAGAAAAATGCTGTTTGCTAACCTAGCCATCACTGAAGAAATTTGTCTTCAAGTGTAG

Transcript

OS493_015661-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4G0P3	Hydrocephalus-inducing protein homolog OS=Homo sapiens OX=9606 GN=HYDIN PE=1 SV=3
Q80W93	Hydrocephalus-inducing protein OS=Mus musculus OX=10090 GN=Hydin PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002241 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_015661-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR033305 all species →	Family	Hydrocephalus-inducing-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23053 all species →	DLEC1 DELETED IN LUNG AND ESOPHAGEAL CANCER 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003341 all species →	Biological Process	cilium movement	Interproscan
GO:0005930 all species →	Cellular Component	axoneme	Interproscan
GO:1904158 all species →	Biological Process	axonemal central apparatus assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015661-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015661-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

92TPM > 0

7Conditions

22.4Max TPM

2.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	14	1.53	3.18
polyp at pH7 6	18	11	1.04	2.51
coral polyp · control treatment	16	16	4.00	22.39
coral polyp · oil and dispersant treatment	16	16	3.51	18.98
coral polyp · oil treatment	16	15	2.12	4.72
coral polyp · dispersant treatment	16	14	2.73	5.62
Polyp	10	6	0.39	1.39

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.18
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.71
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.69
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.59
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.51
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.02
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.91
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.83
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.65
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.20
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.18
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.13
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.10
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.51
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.44
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.94
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.85
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.77
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.64
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.27
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.21
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.11
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.85
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.39
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.24
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.72
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.87
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.37
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.02
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.69
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.50
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.27
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.07
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.90
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.63
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.30
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.19
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.00
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.84
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.98
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.23
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.10
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.06
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.11
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.04
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.77
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.83
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.61
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.46
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.39
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.38
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.29
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.10
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.84
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.99
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.24
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.75
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.72
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.47
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.22
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.02
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.99
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.95
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.41
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.33
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.33
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.00
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.62
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.27
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.52
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.13
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.05
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.99
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.89
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.84
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.75
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.24
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.23
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.98
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.84
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.39
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.64
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.58
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.48
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.14
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.