Gene detail

Detailed information of OS493_015750-T1 in Lophelia pertusa

Genomic Location: scaffold_47:2495367...2505803
NR annotation: KAJ7360640.1, hypothetical protein OS493_015750 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015750-T1

ATGGCGGAACGCGAAATCACAATTGCGGGAAGGAGGCTTTCTCAGTTAAAAGTCGATGAACTGAAAGTTGAGCTAGAAAGACGAGGTCTGAAGAAAAGTGGCAACAAAGGAGTTCTTATAGAAAGGCTACAAGAGGCTATTGACAAGGAGATTGAACTGAAGGAAGGTTATGAGAGTTATACCGTTCCACAGCAAAGGCCAGCACCAGTGCACAAGCCTTGGTCTCATCCTATAATGCAACCACAACGACAGCAGCCTGGTGGTTTCCCTGTGCAGCCAATGGGAGTGCAGCAAGGAATATTAAATCAGCCGCAAGGAATGTTAAATCAGCCCCATGTTATCCTCAACCAACAGCAAATTATGTTGAACCAACAACAGCAGATTACCTCGCCAGTGCAACAAGGAGCCTTAAATCAAATACCATCAATGCCTGAAACTAAACCTTTAACACACCCTTCTAATCACCAAGCTCTTCAACCCACAGTTCAACCAGAAGTTGAATCGTCTAGCTCATCGGATAATGAACAGGACTCTGCGCAGCAATCTTCAAGTTCATCGAGCCCGGATTCAGATAATCATGATCAGGAAAAGCCCACATCATTATTGAACTATAATTATTCCGCAGAATCTAGAACTGATACAAAAGCCGCTGTAGTAGCTGTTGAAGAACATGAATATGGTACAGTTGTGGATGATGGCGTGGGCACAAAGGAGGAGGCTTCGCCGCTGGAGGAGGGAGAGGAGAGGGACGAGGAAGAGGAGGAGAACTCGACTGTCAGAGGTGCAGAGGAAAACGCACATGTAAGACCACATGTTGAACAACGGGAAGAAGGAGATGGAAGAGAAGAAGACAACAAGACAATGCCAGACGAAAAAGGGGAAGAAGAGAAGGCTCAAAAGTTAAATGATGCTCCAGAGGAGAAAGCGAGCATAGTGCCAGAACAGCAGCCATCTCCAGCAGAAGAAAATACTTTTGAAGTTGAGCCAAGTGAGGAGGACAAGGCAGTTGTTGAAGAACCAAAAGTCCCATCCCACCGGAACGTCGCTGCCAGCACACCAACTTCCGAGGGACAACCAGCCTCAAGGAAAAGAAGATGGGGATCAGCATCATCAAGCAAGAAGAAAACTTCTTTGTCCATTAGTACAGATTCTCTCAAGGATCTTATTCCTGGAGTACAAGTGCACAGTACGCCAGCCCTGGAAGCTGTCATGGATATCGGAGGTGATGACAACGATGAGGAAGAGGAGGAGCCCGAAGAGAAGAAGATGGCACAGAAAATTGACGAGGAGAAAGAGGAAGTACCTGTGGTAACAACACCTGAAGTTAAGGAGGAGGGTAAGAGAAGAAAGGAAAGGATTGTTAAAGTGGAAGAGAAGAAAACGATCAAGCTCCTACGAAAGCCTGTCGTTATCGAAACTGAACAGGAAGCAGTGAAAATGGAGGTTGAAGAAGAGCCTTTAGAGCAGATATCAGAAGATAACCCGCATCCCAGGCGCACATCACTTCCAGTCCAAGAAGCATCGTCCCCTGCGCCAGCAGAGCATTCACCATCACCTGCCAAAAATCCACACAGTGAAGCGCTGCATGTGAAGAACCTTGTGCGTCCATTCATGCCAAACCAGCTCAAAGATCTGCTTGGCAAACATGGAACCTTGGCTGAGGATGGATTTTGGATCGACAAGATTAAGTCTCATTGTTATGTTGTGTACACCGATGTTGAAGAAGCTGAGGCCAGCAGACAAGCCCTTCATGGTATCAAGTGGCCATTAACAAGTCCAAAGATCCTTGATGTAGATTATGCTGATGAGGATCAGATGGCACGAGATACTGAAGGTGTCTTGGAAGAAAAACCAATAGAAGTGGAAGAGGAGGAGGAGGAGGTACAGAAGACCCCTGGTAACCTGCTGGATAATCTGTTCAGGAAAACCAAGACCGTGCCCTGTTTATACTGGATGCCACTCAGTGATGACCAGATTGTAACGAGGGAACGCGAAAGAGAGGAAAGACGGAAAGCAAGGCAGGAAGAGAGAGACAAAAGAGACAAAGAGGATGAAGAACGCAAGGAAAAGCAACAACAACGAGAGAAAGAGCGGGAAATAGAGCGCGAGAAGGAAAAACAAGACCGCGAAACAGAGAAGCAACGGTCACGATCACGCTCACCAAGAAATAACAACAGAAGAAGAGAGAGAAGCAAAAGCAGAAGCAAAAGTAGAAGTCGAGGGCCGAGACGGCGATGA

Transcript

OS493_015750-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UKV3	Apoptotic chromatin condensation inducer in the nucleus OS=Homo sapiens OX=9606 GN=ACIN1 PE=1 SV=2
Q9JIX8	Apoptotic chromatin condensation inducer in the nucleus OS=Mus musculus OX=10090 GN=Acin1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004284 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16294 all species →	RSB_motif	RNSP1-SAP18 binding (RSB) motif	Motif	Interproscan
PF02037 all species →	SAP	SAP domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003034 all species →	Domain	SAP domain	Interproscan
IPR032552 all species →	Conserved_site	Acin1, RNSP1-SAP18 binding (RSB) motif	Interproscan
IPR052793 all species →	Family	Exon junction complex-associated protein	Interproscan
IPR034257 all species →	Domain	Acinus, RNA recognition motif	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR036361 all species →	Homologous_superfamily	SAP domain superfamily	Interproscan
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46589 all species →	APOPTOTIC CHROMATIN CONDENSATION INDUCER IN THE NUCLEUS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0008380 all species →	Biological Process	RNA splicing	Interproscan
GO:0061574 all species →	Cellular Component	ASAP complex	Interproscan
GO:0071011 all species →	Cellular Component	precatalytic spliceosome	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12875	ACIN1, ACINUS; apoptotic chromatin condensation inducer in the nucleus	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015750-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

141.5Max TPM

78.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	82.95	117.68
polyp at pH7 6	18	18	79.97	109.65
coral polyp · control treatment	16	16	91.79	141.52
coral polyp · oil and dispersant treatment	16	16	75.37	97.20
coral polyp · oil treatment	16	16	89.75	101.32
coral polyp · dispersant treatment	16	16	68.46	106.94
Polyp	10	10	51.22	87.47

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	117.68
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	117.11
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	117.06
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	116.31
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	106.90
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	106.71
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	95.70
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	94.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	82.04
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	81.66
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.69
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.64
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.84
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.30
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	58.32
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.23
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.02
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.49
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	109.65
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	106.29
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	97.88
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	96.54
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	96.20
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	90.86
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	89.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	86.36
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	81.24
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	78.79
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	74.56
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	73.84
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	69.43
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.97
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.96
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.50
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.59
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.69
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	141.52
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	129.67
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	113.10
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	107.28
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	105.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	99.08
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	98.99
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	98.53
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	84.65
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	83.46
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	81.29
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	80.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.20
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.48
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.95
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	97.20
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	94.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	85.23
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.95
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.81
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.67
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.46
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.87
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.08
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.85
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.23
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.39
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.07
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.53
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	101.32
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.98
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	98.01
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	96.71
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	94.87
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	93.77
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	90.32
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	88.60
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	88.28
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	87.01
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	86.84
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	85.61
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	85.30
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	83.55
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	82.86
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	72.01
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	106.94
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	105.05
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	100.07
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	92.78
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	87.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.28
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.37
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.74
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.46
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.14
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.88
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.09
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.45
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.62
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.28
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.87
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	87.47
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	83.06
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	76.37
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	64.56
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	62.42
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	43.51
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	29.50
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	22.83
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	21.28
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	21.18

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.