Gene detail

Detailed information of OS493_015788-T1 in Lophelia pertusa

Genomic Location: scaffold_48:524717...545046
NR annotation: KAJ7333705.1, hypothetical protein OS493_015788 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015788-T1

ATGCCTTTGAAAACACTGATTGAACTACTGAGTTGTGTTGCCTTTTCTAACACACAGGTTGTTCAACAAAAAGTCAGTAAAAGCAAGAGTTCTGTGAAGATCTCAGATCAGGTCGCCAGGAAGAACCCAAAGTTGATTGAAGCCGTGTTTTGGTCATCTCTGCTGGATAATGTGTTCAAGGAGAATTTAAAGAATGATCCAGAACTTAGGTGGCAGAATTTTGGCTCAATCGAGGGCTTCCTCAGAACGTACCCAACCCGTGAATGGTCCTTAAACTTTGCTGGTTTCCAGATTGATTATGATCCCAGATTGAGGCCCTGGTATATTGGTGCCACGTCGGGTCCTAAGGATATTGTCATCATCCTCGACTGCAGCTTGTCAATGGAAGGGAATAAATTCCACATGGCTAAACAAGTGGCAAAGACAGTATTGAATACACTCACCAAACAAGATTATGTCAATGTCATTTGCGGCCATGACGGTCATTATGATGAAGTTGGGAAGTGGGTTGAATATAAAACTGAAGTGCTTAGCTGTCAACAGAACCGACTCGTACCAGCATCCACTTCTCACAGGAAGGACTTAATCGAAAAGATCGATAATCTGAAGGCTGGAGGAACAACTGATCTCAAGAAAGCGTTCAAGTTGTCATTCGAACTGCTTCAAGGAAATGCCAGGACAGGCTGTCAGAGCATCATCGTGTTTGCTACAGATGGAGAAGACAATGATGGGGACCCTGTGCGCTGTGGCAAGGGTTACTACACCAGGAGCGGTTATGTGCCAGGACAGATCTGCCAGTACGACTGGAATGATGTGTGGGATGAAGTGCAGGCCAGGAACAGATACATGAGTCCCAGGACTCGAATCTTCTCGTACCTAACCGCGGACAATGGTGAAGAATTCCCAGGAAAGTTGTCTTGCGACAATCAGGGCTATATGAAGAAACTAACAGATGAAGAAAACATCATCTCACAGATGCAGGATTATTACAGCTTCCTGGCTTCCAATACGATCAGTGTCAGTAATGTCACGTGGACATCTCCCTACCTGGACGCGTCCGGTCTGGGACTCATGGTCACGGTAGCCATGCCTGTCATCAGTAAAGTCACGAACAAGACAATAGGCGTGGTTGGGATTGATGCCACGTTGGAGGAAATCGAGAACATCTTGTTGAACGACCAGTGGGGTTCAGTTTACGCTTTTCTGGTGAATGAACGAGGAGAGACAATCTTTCACCCGCTGCTACGACCAAGTACTGAGCTCGTGGATGATCCAATCTTTATTCCAATTAGCACTCTTGAACAGCGCAACGGTAAACCTACGGAGTTCAACACTGTGGCCAAATCCATGATGGATGGTGAAACAGGCTCCCTTAGAATCGAAGATGCTATCAGAAGCATTCCAAAAGGCGATTTTCAGGATGGCGTGATGCTTGTCACGCTTCCTTCCACCTATTACTACACGTCAATCAAAGACTCCGAGTACGTGTTTGCCTTCAACCTCGCAGACTCGGATAAAAATTACCGCAGACCAGCATCACCGCCGCGCGGAATGAAAATCCCGGTGAATTATTACGCGAACATCGAGTCATACAACTCCTCTGAAGTCAAACAGGTGTTAGGTGATTTGTACACAGACCTCGATGTACAGCACAACCTCGCCTTCTTCCCTGATGTTCCCGTGACGTTCAACTCTTCCACTGTGATGTTGAGCCCGAAGACGTACTGTCACCCAAACACCTTTCTATTCAGAGAAAACAACAGTGATATTGCCATTGAGGCCCATCGCTTTCTGAACGGGATAGGCGATAACATTGGTTGTCCTCAAGGCCGGTTTCGGGCTTCCGTCAGACCGGATGTGGAGATCACATCGTTGATAGAGGAGATATGGAAGAATAATCGCTCAAGCGAGATTTTGAAAGACGTACCCTGGACATACATTGGCACACGGAGTGGTATCTTCCGCTCCTACCCAGGCCACCGCTCGAGAAAGAACTTCGATCCTACCAAGCGGCCGTGGTATCATCGTGCCCTTGTGAACCCATCCAAAGCAGCCGTGTCGAACGCCTACATGGACGCTAATGGTATTGGGAAAGTGATCACGATTTCAGAAGCTGTTTTCCAGGCTCCGCCTCAAAACACGTCCAATATGAGTTGCGGTAGCATGGACAATCTTCAAGGAGGATGCCCTTGTGCAAGGGACGTTCAGTGTATTTCAGGCAAGTGTCGTGTTTACACTGGGAATCGTTCCTTGTGCGCCGGAGATCGCGTGGAGGCAGTCACAGCTCTGGATATCTTGTACAACGACTTCCATCGTCGTATGTACGGGCTTCTTAACAGCTCAGGAGAGGCAAAATCATGTGGAATGAACTACACTTGTCCTGATGGCGAGCATCTGTGTCAAACAAGATGCTACCTGATGGATAACTTGGCCAACTTGGTCACTGACCCAGACTTCCTCCTCGTGAGTACCACGGACGCGCGGGAATACGAACGAGTGAGCCTGGGACGGAAAGAGGGTGACATAATGAAACTGTTGGTCACAAAGCACAAGTTCTTTGTTCCGAATCAACGGGTTGACTTCCAGGGAATATGCAGTGTGTCTCCATACGCACCTAAAGTGACGCTAGAAGGTATTGTTAGGACGCCAGAACAGGAAGACGATTACTACAAGAACAGAGGACCAATTCCACCATTCAGAAACGAGTATGGCTGCATTCAAGATGTTGTAGGCTACACGTCGGACGATTCGGTTCTTGGTCCCGATGGCATTATTGCCGACTCAGTAGATGGCCCCTGTCGATCCGGGAACTTCTTTCTCTCAGCTCTCCCCAGGACCAATCTTTATCTACTGGTGATAGAGAACTGGAGCGAGTACCGTCAATCGTATTTTTACAACTTCAACTGTCACATCAGCAACAGGGTCTTCGACGCAGGCGCGTTCCGTATCGTGAACGGCACATGCGCGCACATTGAAACCGAAGCAAGTCTTAAAAAGAAAGAAAAGTGTCCGGCGTTGAAAAACGTGCATATGCAGTGTAGTTACAATGTATCTAACGCTTTAACGCTACCAAGTCTTCTACAGCACCTTATAGCTACCTTAATTGTCATTTTGAATTGGAGATAA

Transcript

OS493_015788-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A8XP97	Voltage-dependent calcium channel unc-36 OS=Caenorhabditis briggsae OX=6238 GN=unc-36 PE=3 SV=2
P34374	Voltage-dependent calcium channel unc-36 OS=Caenorhabditis elegans OX=6239 GN=unc-36 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007511 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08399 all species →	VWA_N	VWA N-terminal	Family	Interproscan
PF00092 all species →	VWA	von Willebrand factor type A domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013608 all species →	Domain	VWA N-terminal	Interproscan
IPR002035 all species →	Domain	von Willebrand factor, type A	Interproscan
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan
IPR051173 all species →	Family	Voltage-dependent calcium channel subunit alpha-2/delta	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10166 all species →	VOLTAGE-DEPENDENT CALCIUM CHANNEL SUBUNIT ALPHA-2/DELTA-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005245 all species →	Molecular Function	voltage-gated calcium channel activity	Interproscan
GO:0005891 all species →	Cellular Component	voltage-gated calcium channel complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015788-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015788-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

8.9Max TPM

3.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.26	6.63
polyp at pH7 6	18	18	3.60	4.81
coral polyp · control treatment	16	16	2.99	8.92
coral polyp · oil and dispersant treatment	16	16	2.09	6.57
coral polyp · oil treatment	16	16	2.99	7.39
coral polyp · dispersant treatment	16	16	3.88	8.62
Polyp	10	9	2.46	5.39

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.63
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.34
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.79
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.54
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.21
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.20
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.51
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.50
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.32
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.13
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.07
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.76
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.17
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.06
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.89
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.83
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.61
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.11
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.81
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.75
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.67
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.28
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.23
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.08
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.96
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.88
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.77
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.25
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.95
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.68
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.40
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.30
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.25
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.92
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.76
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.89
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.88
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.55
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.14
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.70
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.63
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.59
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.96
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.82
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.82
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.45
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.57
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.51
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.57
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.47
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.94
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.90
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.80
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.28
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.06
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.85
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.28
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.23
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.75
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.47
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.45
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.45
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.39
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.44
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.17
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.82
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.50
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.40
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.31
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.15
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.85
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.10
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.77
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.72
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.59
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.23
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.49
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.62
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.68
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.95
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.75
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.34
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.69
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.70
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.68
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.61
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.40
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.10
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.16
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.40
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.39
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.10
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.58
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.18
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.07
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.26
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.65
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.