Gene detail

Detailed information of OS493_015801-T1 in Lophelia pertusa

Genomic Location: scaffold_48:648695...659197
NR annotation: KAJ7333718.1, cell cycle [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015801-T1

ATGGAAAATATTGCGACGAAGAAGTTCGTGTACGACCATGTGTCGTCCTACAAGGCTCGCGGAAAATCGGGAGCTTCAAGTCGGAATGTTCGGGTTCAACGAGCGAGCGAGAATCGTCAACGCTCAAGGATGGATGAAGTTTCAAAACGAAGACGAATGCCTCTATCTCCACTGGCTGATGAAAACGCTGTTGACAAGGGTCTTATAGCAGAAGAAAACGAAGAACAAAATGATAAAACTTCTAATCCAGACCTCAGCAGGAGGGATAGATTGCTGAAGTGGCGCGAGGAGCGACAACAAAAGAAAGGAACTGAAGCTCAGAAGAAGTCTTTTGTGGTGCGACACGTCAAATATGACAAAGAGGCTACTTTGTTTGCTGGTGAAATGAAGAAAGCAGCCAAAGGGCTTGCCCAACTAATCAAGCCCAGCCAGTATGCCGTGACTAAGCCTGAGAAAAGAGTCACTAGGGCTTCAACCAGGATTGCTAAGCAGAGCTCAAACTTGGCAGCTGACCTGAAAACAGTGAAAAAGGTGGAGCCCAAATCTAAAGCCGCAGGTAGTGACAAGCTACATGTAAAGGAGAAGACTGAAATCATCCAAGAAAAGACTGCCAGAGTCACAAGACAAAGTCTGCGAACAAAGTCATCTTCATCAGGCAAAGGTGTTGCAGTTTCCCAGTCCAGTAAGAAAGTGGCAGCTGAACCAAAGAAACAAGTCAAGACAAGATCTCAAGCCAAGAAGGTGAAAGATCAACCTCCAAGTGAAATTCAATGCCCCTCTAAACTTGACAAACAAACTGGTCAAACATCGCCAATTGAAGAAAAAACTGCAGCTTTTGAAAAATTGAATTTCCCACCACTGGACAACATCAAGAATACTGTTTCATTTGGAAGAGGGAGCACAGAGGGTGCGGAAAGAGGTACAGGAACGGAGGCTCAATCTTTTGCTCCTACGGACTTTCAGTTCACTGCACCCAGTGGCGTCAACACATTCACTTATTTCTCGAAAACATTCAAGTTTCAGCCCCTTAGCCCTAACAGTGCGACAGAATTCATGTTCCCGTCATCATCATCGTCATTGTTTAGCCCCAAGGCAGATAAACCAGCCGCTCAGAAGCAGGGCGAGAATGCAATTTATGAAGATCCAGTGGCAGCTTGCCATTTAAATAATGAAGTAACAGCGTGCGAAAGCAATCCACAGCAGCAGGCTGATCATGAAATGATTGACGCAGCATCAGAAACTTGCAGTGTTCCCATGGAAACGTGTGATGGATCTGAAAAGCGGCAAAGTGGTGATGAAGTTGTGGAAAATGACTGCACTTCTCAATCAAGTGACGGAGAAATCCCAAGCACTGATCAGCAGCAGTCGGAAGGTACTGTTGAAATGGACACAGGAATGGACAGCGGTGATGTTCTAGAGGATCAGGATGTTGGTGGTGAACAGCACGATGCAACGTACTTTAGGAATCTTGTGAAAAGGGAGACCGATGGGCTGAACGAGATCTGTGCGCAGTGGGAGAAAATCAATGCTGAAGAACAACATCTCAGTGAAGAAGTGTCTGGTCAGATAAGGACTACTATTGGGCAAGGCCAGCTGTTGATTGATCAGCGGTTTCGTCAGTTTTCAGGTCTTATTGATATGAGTGAGGATAAAAATGCAGAAAAGCAAGCAACTGCCTCAGACCTTCAGGGATTCTGGGAAATGATTTATTTTCAGGTTGAAGATGTGAATGCTAAATTTGACGCATTGAAGAAGTTAAAGGAGAACAACTGGAAAGAAGAGGAAAAGAAACCAAAGAAAGTCACCAAAAAGTCTAAGGCTAAGAAACCAACAGCAGGCGATGATGCCGGCAAACCCAGCAACAAACAAGGCGCTGCAAGAAACAGAATCCAGGAAATGAGAATGGCCATGAAGGCAAAGATGGCGGTAGACAAGGAAAAACTGAGAGCAGAGAAACGACACCAAGAGGAAGAAGCCTTTATAACAATTCTTACCCCGGTGAAAAAGAGCAAGAAAAATGACGGCAGTGAGGAGGTGGTGTTGACCCCAGTACGCCGCTCCATCCGCAAGACTCCACAGATACGATCCATGCTCGGTAACAGCACCACCCCTGTGGTGGTTACCACGCCTAAAATCATCAGTGAGAACAGCCCTGGGCTTAGACTAACACCAGACAATGGCAATCTACCCATCGAGTTAGCTATCACAGGAATTAGCGTCGCGCAGGTTGACGACACACGCGAGGAAGGCGAAGTCGCGCGTGGAATGGATCTTCAACTAGAGGAAGATGAAAAGCAGTGCGAGCTCAAGCAACAGGGAGAAGCAGTTTTGAAATCTGCTTGCAAGTCTACAGAGAACAAATCTCGTAAGAGCTCAGGAAAAGTGACTTTCCAGTCGCCGGACCAAGAGAGTACTCCAGAATGCGCGGTACATGAAGTAGCTTATAGTCCTATGGTGACAGCTGTCCCGGATAGTGCAGGCTCAGACGAGAACAGAGCCAAGAAGCCCACCCCACAGCGTTTCTCAGCGCGGAAGTGTCGCAGTCGAATGGGAACACCCTACTACCAGCAGGGACCCAGGAGAAGGGTGTCCGTAGTCGATGAAGATGTTGGTCATGAAGCGGAGTCTAGCGAAGGGCGAAGCTCGTCAGATTCCGAATCTAGCGATGCAGCCAAAGCTACAGAGCACTGTCCCAGTTCAGGATTGAGAAGATCATCGCGAAGAACGCCTTCTAAATACCGAGATTCCACTCCATTGGAGGGCGTGTCTGACCAGACAGGAAAGACACCTGCTGACGTTTCAGTGAAACTGTTCCACGCGGCGGAGGAATCCACCACACGCGAGACTCCTAAACATGGTTTAGAACAAGACGTATTTTCTAAATATCTTTGCTCATCGTCGTCCGATGAAGAAGACTGCGTTAAAGAACCGGTTGTTTCTGTCAACGTGGCTGAAAATGACGTGTTCGAAGATGAAGCAACAAGACCGGAAGACTTCGCTGTGAACGAGAATGTAAACCTCACTCCACCCGAAGAACCCCACAGCTTCATCAGGCCTTCGATAACGAACAGCGAGCCTAAAACGGGCAGAACACCCATACACTTCCTGAGGTATCTCTCGGACATAGATACACCGTCGCCAAATTCCCGCCAAATTACACCCATGCCCAAAACCACCATCTTTATGTCGCCGTCGGGTTCCAGCAAGACTCCAGCTCTTGCGGACAGTTTAGGGATGATGTCACCGGAGAACGCCGTACCCCGATTTCCCGCCAAAAGTGAGGAGGGCTCGCCGCTCCTTTCGCTTGCTCCAGTGGCGGGAAAAGAGAGCCCCGCCCCTGTGACGCCATGCAGTCAGCTGGCTGCATTTTGCCTCGATGATTCTCCTGTCGATAGCGAGAAGCGAAGAGACTCGGTTTTCTTTGCGCCCGGCTCAACTGCTGTGATCAGGGCACAGGATAACTTGATGGCCTTTTCACCGGTTCTGGATGCGAATGAGACAGAGCAAGAGGAAGTGAATTTGTGA

Transcript

OS493_015801-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8K4R9	Disks large-associated protein 5 OS=Mus musculus OX=10090 GN=Dlgap5 PE=1 SV=2
Q15398	Disks large-associated protein 5 OS=Homo sapiens OX=9606 GN=DLGAP5 PE=1 SV=2
P97837	Disks large-associated protein 2 OS=Rattus norvegicus OX=10116 GN=Dlgap2 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006831 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03359 all species →	GKAP	Guanylate-kinase-associated protein (GKAP) protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005026 all species →	Family	SAPAP family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12353 all species →	DISKS LARGE-ASSOCIATED PROTEIN DAP SAP90/PSD-95-ASSOCIATED PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0023052 all species →	Biological Process	signaling	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0007052 all species →	Biological Process	mitotic spindle organization	Interproscan
GO:0007059 all species →	Biological Process	chromosome segregation	Interproscan
GO:0007346 all species →	Biological Process	regulation of mitotic cell cycle	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0031616 all species →	Cellular Component	spindle pole centrosome	Interproscan
GO:0051382 all species →	Biological Process	kinetochore assembly	Interproscan
GO:0051642 all species →	Biological Process	centrosome localization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16804	DLGAP5, DLG7; disks large-associated protein 5	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015801-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

18.1Max TPM

4.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.65	6.82
polyp at pH7 6	18	18	3.63	5.66
coral polyp · control treatment	16	16	6.03	18.14
coral polyp · oil and dispersant treatment	16	16	3.81	10.56
coral polyp · oil treatment	16	16	5.78	14.01
coral polyp · dispersant treatment	16	16	3.66	6.69
Polyp	10	10	2.28	5.62

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.25
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.95
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.35
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.62
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.29
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.88
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.83
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.34
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.74
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.23
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.18
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.17
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.78
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.66
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.58
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.58
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.48
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.43
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.26
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.07
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.53
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.82
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.53
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.46
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.82
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.16
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.98
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.76
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.41
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.28
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.12
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.14
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.07
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.86
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.42
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.29
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.73
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.54
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.98
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.25
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.54
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.36
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.09
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.03
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.96
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.43
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.56
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.94
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.99
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.91
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.88
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.88
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.56
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.46
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.08
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.76
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.06
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.54
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.33
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.63
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.48
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.01
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.45
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.14
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.70
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.63
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.88
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.80
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.61
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.24
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.42
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.96
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.59
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.33
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.78
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.60
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.34
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.69
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.10
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.68
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.16
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.86
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.27
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.23
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.49
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.71
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.53
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.53
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.87
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.77
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.66
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.62
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.04
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.65
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.14
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.22
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.22
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.09
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.68
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.63

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.