Gene detail

Detailed information of OS493_015807-T1 in Lophelia pertusa

Genomic Location: scaffold_48:723138...742311
NR annotation: KAJ7333722.1, 3-dehydrosphinganine reductase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015807-T1

ATGTCGTCGAATGGAGTGGCCGTGGCGAAGGTACTCGAGCAGATCCAACTGGCACAGGGCATGATTGACATGAACGCTTCGAGCTTGAACAGTCTTCGAACACAGTTTTCCACCAACAGCGACTTGATCCAGCATGAAATTCGCACCCTAGAGGGAAAGCTTGTAAAACTGTTTTCAAGACAGTTGGTTGCCAAGCAAAAGTGTAATGAAGATTGGAACCATTGCGAGAAACTCCGTTATTATCCTAAACTCGAACAGTGGCTTCAAGTAGTGGGAATCAACGAGGAGGCGATCAAGAATTTGGAAGAGAAGTGTAGCACAGTGGAAGGCCTTTTGTCCCTCTCTGATGAGAAAGTAAAAGCTGTACTTGAGAACTATGCCGACGGACAGGAAGAGAGTAGGAGGCTGATTTCTGCTCTGAAACATCTGCATGCATATACAGAACGACAGAAGCAGGGTCACAAGGACAGCACTTCAGATATTTACTGGGATTCGTGGGACACTGGAAAAACAAGAGAAAAGAGCCTGTCCATCAGTGCTTCAGAGCGGTCGTCACGTTCCTCTGTCACCTTGGACAATGACATACTGTTGTCATCACCAAGCTCGGATGCAGACACGGAAAGCTCCAGGCTGTCAACGTTATCAGCAGATACTGATGGTGCACGTAGTCCTAAGTACAGTCCACACCCATATTATTTCATGAAGAGAAGTGTATCGGATGATGCAAATTTAGGAAACAGAATATTTATCAACAGTGAAAATCCAAATGCGACAGTTGGGAAAAAGCAAGGAAGAAGGCTTGGACCTGTCACTCCTCTCACAATACAGATTCCTAAGAGTACAAGCGGTGACATCTCGCTTCATTCCCAGTCTGATTCTGAATCAGATCACAATGCAAGTTCCCACACAATAGGTTCTCCATCAAGGATTACGCACTATGGCATGGGTCATACAATAAAACACAGGTTTTCACAGAAGACATTTATGGTTAGCTTGGCATGTGATTATTGTCATAAAATCCTTTTGGTTGGTGTAAAATGCAAAGATTGCAAGCTTAAATATCACAAGAAATGTTCTAAACTGGCTCCTCCTGCCTGTGGGCTACCAAAGGGATGTGGCGAATTTTTCACCGCTCAACTTCGGCGAGCCTACGATTATCGCTCTTTACCAATGATACGCTCTCATGTTAAGAGAACAAACTCAGAGCCATCCAGCATTGCCCTTCAAGTTGAGCGTGAGCAAAGATTGAATGCCAACCGTAGCCATGGTGACTTAAATACAGTTGACCTCAAGTCATGGCCTGCTCCCATCCGCAATGAAATTCCGTCTCAGTTTACAAATAAGGGAGCAAGTGGAGACTCTTGTTCGGCTTCCACATCATCGTCAACATCATCACCACCTTCGTCGCCTCCTCCAGCAATTACAACTACATGTAGTGTTAGCCTGTCGGCACAAGAAGAACTTGACCAGTTTCCAGGGTCACATTTTTCTTTTACAAATGTTTCAGGAATGACATCTGCCATGCAGAGTGATGAAATGATTGACTCAACCAGTACCTTGGTGAGAACAGAAAGTGTGAAATCACGGCAGAGTAACAACACTACAACAAGTAATGATTCGACATTGTCAGGAGAGGATGTTCCAGGCATTGAGTCACTGGACAGTCAAATCTCTGATGTAGATCCAGAGAGCAAAACATGGGGGCGTAGAGTGGTTGGAAAAGCGTACATGCTCTGGGATTTACATCAAAGAGGCAGCTTGATGTCCGAGTGGGTAATTCCGTTTGAAGAGCTAGAGATCAGCTGGACTCCACTGGGTACAGGCAGATTTGGAAAAGTTTACAGGGGTCACTGGCACGGTGAAGTGGCAGTGAAGATGATCGAGATTGAAAATCCAACTGAAGAACAGCTGAACGCCTTCAAGTTCCAAGTTGGAACATTTCGAAAAACTCGCCATGAAAATGTAGTGCTATTCATGGGCGCATGCATGGATCCACCAAAACTCGCTATCATAACAAGCATGTGCCGTGGTAATTCAGTTTACACTCACATACACGTACGAAAGGACAACCTTCCTCTGCAAAAAATCGCGCAGATTTGTACTCAGATTTCTCAGGGGATGGGATATCTTCACGCTCGAGGGATCGTACACACCGACCTGCGCTCGAAGAATGTTTTTCTGGAGTTAAACAATCGTGTGGTGATCACGGATTTCGGTTTGTTCAGTGTAGCTGGTTTGACCACCAAGTCGGCCAGACCTGGGCTGCTCATGATTCCAGAAGGATGGCTGCCGTATTTAGCTCCTGAAATTCTTCGGTCTCTTACAACCCAACAAGATGCTCCTGATTCTTCACAGTTCACTATGGCAACTGATATGTACGCCTTTGGGACTGTCTGGTACGAGATGTGTTCCGGCTCATGGCCTTTCAAAAAACAAATTCCTGAAGCCATTATATGGCAAGTAGGCAAAGGAGTTAAACAGTCGCTAGCGACTGTGGACGTTCCACGGGAGGTTAAGGATACTTTAACGATTTGCTGGGCATTTGATGCAGATAGGCGGCCCTCTTTTCAAACTTTGCTCAGAACATTAGAAAGACTTCCTAAAATAAGACACACACAGCGGCTACACAGAAGCCCATCCCAACCATGTACTGTGGGGAGAGGGGCTGAGGCGCTTATATAA

Transcript

OS493_015807-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q61097	Kinase suppressor of Ras 1 OS=Mus musculus OX=10090 GN=Ksr1 PE=1 SV=1
Q3UVC0	Kinase suppressor of Ras 2 OS=Mus musculus OX=10090 GN=Ksr2 PE=1 SV=3
Q6VAB6	Kinase suppressor of Ras 2 OS=Homo sapiens OX=9606 GN=KSR2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001449 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20406 all species →	SAM_KSR1_N	Kinase suppressor RAS 1 N-terminal helical hairpin	Domain	Interproscan
PF13543 all species →	SAM_KSR1	SAM like domain present in kinase suppressor RAS 1	Domain	Interproscan
PF00130 all species →	C1_1	Phorbol esters/diacylglycerol binding domain (C1 domain)	Domain	Interproscan
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002219 all species →	Domain	Protein kinase C-like, phorbol ester/diacylglycerol-binding domain	Interproscan
IPR046861 all species →	Domain	Kinase suppressor RAS 1, N-terminal helical hairpin	Interproscan
IPR025561 all species →	Domain	Kinase suppressor of RAS, SAM-like domain	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR046933 all species →	Homologous_superfamily	Kinase suppressor RAS 1, N-terminal helical hairpin superfamily	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR050167 all species →	Family	Serine/threonine-protein kinase	Interproscan
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR046349 all species →	Homologous_superfamily	C1-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23257 all species →	SERINE-THREONINE PROTEIN KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0007265 all species →	Biological Process	Ras protein signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015807-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015807-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

53.5Max TPM

21.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.99	24.58
polyp at pH7 6	18	18	18.10	28.71
coral polyp · control treatment	16	16	22.42	33.87
coral polyp · oil and dispersant treatment	16	16	32.26	53.47
coral polyp · oil treatment	16	16	29.13	43.35
coral polyp · dispersant treatment	16	16	17.61	28.35
Polyp	10	10	17.79	30.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.58
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.06
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.94
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.45
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.09
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.44
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.26
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.35
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.66
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.61
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.54
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.52
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.52
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.99
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.13
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.90
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.71
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.35
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.15
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.23
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.22
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.55
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.18
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.77
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.61
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.40
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.56
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.94
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.81
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.11
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.10
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.87
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.87
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.24
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.66
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.96
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.52
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.48
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.44
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.02
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.28
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.05
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.41
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.64
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.59
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.20
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.90
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.49
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.47
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.08
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.47
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.35
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.74
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.78
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.45
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.16
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.29
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.89
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.98
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.97
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.88
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.62
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.16
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.35
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.46
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.82
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.03
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.73
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.11
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.69
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.79
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.96
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.31
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.56
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.24
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.06
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.81
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.44
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.64
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.35
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.77
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.57
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.41
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.89
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.20
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.73
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.22
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.89
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.62
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.98
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.89
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.11
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.10
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.20
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	30.67
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	23.67
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	21.81
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	20.24
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.52
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.40
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	16.37
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.19
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.36
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.67

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.