Gene detail

Detailed information of OS493_015857-T1 in Lophelia pertusa

Genomic Location: scaffold_48:1249724...1276059
NR annotation: KAJ7333766.1, hypothetical protein OS493_015857 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015857-T1

ATGGGTCTTAGAGAGTCAAAACTTTGCTTCCTTCCTTACGAGGAAGCGACGAAGAGGGTTACGGACGATGAGATGCAACGTCTGAGACTGGCGTTTAAACGCTGTTCTGGTGTGAGTGGATTGATGCCACAGCCGGTCTTTGCTCGTGAAGTGCTTGGCGATGGTGTTCCGAGCAAAGTCGCTGAGCAAATTTACACAGCGTTTGGTGGTACAAACAAGGGAATAACATTTAGAGATTTACTTTGTGGTCTCGTTCTCCTGACTCGGGGCACACGTGAAGAAAAGATAAAATTTATTTTCAATATTTATTCTACCGACGCGGCGTTCGTGTACAAAGATAATATGGAAAGTTTAATTTTGGCTTGTGATGGTGGCAATATTCCTCAAGCGGTCATCGAGTGCTTCTCCCAGTGTGACCGCCTGACATTTGAGGAGTTTACCAGTTGGTTACTAAGGAATCCTGATGTGACCACACTCACAAGGTGGTTGCTTATTGTCAGTAATGGTTGCAGTATTCAATTAACGGACAGCAGTGAGACTCCCACATTTTACCAGACACTTTCTAGTGTAACCCACTTGCAAGAGACAGATATCATGGAATTAGAGAAGAGGTATTGGACGTTAAAGTCTGGAACAAAGACTGGCAAATTTGATGTGGATACATTCACTCCGCTAGTGTCACCACCCATTCCGCGGTGTTTATGTCAAGGGCTGTTTAATGCTTTTGATGAAAATCAAGATGGTCACATTGATTTTCGTGAGTTAGCTTGTGGTATCTCCAAGTGCTGTAGAGGACCTAATGCTGAAAGACAAAAATTCTGCTTTAGGGTATTTGATTCTGATGGAGATGGTTTTCTATCAAGAAGTGAAATTGAAGTAATGTGTAAAGCTCTTATTGAAATCAGAAAAGAAAATGTTGGAGAAAAGGACACAAGTACGATTTGGGACAAGGATGTTTCTTTAATGGCAACTGAAATCTTGAGCGACTGTAGCAAAGAGGAGGACGGTCAGATCAGTTTAGAAGAGTACAAAGAATGGGCATCGTCACGCAGATTTTCTCATTTGTTTCCTAAGTTGCTGGTACAGGTTTGTCACATTGTACTGGGGCTAAAGCCGATCACTAGAGAAGTTGAACTTCAAGTTGTAAGAGGGTGGCTTGAGCGTGAGTACCAGCATGAGCTCAAACCAGGCACTATTTGGTATCTCGTTGCTATATCTTGGTGGCGGATCTGGAAAGAGTATGTCAGTTATCAGCCTTACATCAGACGATCGTCAACTGGTAACCTGCGGAAGAATGGTACACTGCCAGCAAGACTAAACCAAGTACATCATGTATCATCTGGCAATCCTGGGCAAGCTTGGAGCAGTGACTCCAGTTTGAAAACAAGATCGTTAGGACGGCGCGAATCCCATCCAATGTACAACCAGGCTAACAAAGCAGTTAGTCCGTCTGGTGCAATGAATGGTCACTGTTCACAGGGCGTGGCATGCGGCACACAAGTGCCTGGTCCTGTTGATAATGTGCCACTTGTAGAGACTGAGACAAGGAAGGTGATGATCTTAACTGGTGAGGGAGGAAAGTTAAAACGTAACATCCCGTTATGCAGAGGAAGAGACTTTGAGATCATACCTGAGCCAGTGTGGAGAGCTCTTCAGCAGTGGTATGGAGGAGGACCAGCTCTTCCAAGAACGGTTATTAGTCCTACAAATGGCGATCCAACTCCAGAGTTAGAGTTATATCCAATCAGTCTGCGACTGTTCCGACATGCTCCTCCCCCCACTCGAGGTGGAATCACAACATGGACTGGAGTGGGGTTTGGATTGAGTACGTTTGGGTTTGGTACCAATTCTCTTACCACTCCTCATGCCCCTCCCAAGAGGTACCTGGCATATGTGGCATCCTTTAGTCGAATGAACACCATACAACAGGTTTATGACTATCTTTGTGCACGTCTCAGAATCCGTGCAGAAGATTTGAGGCTCTGGACTATGGAGGACGAGAATAAACTGAGACTTTTAGAGGAAGACAGTTCCTCGCTAGAAAAGTTGGAAATCACAGACAACCATCCTGTACTTATTGAAGTTCGCAACAGAGATATGAGTTGGCCAGAGGAGATGTCCTCTTTAGCAAACAACAGAAGTCTCAGAGAGAAGCTTAATCTTGAACCAACTGAAAAAGGAGCCACTGGTCTCAGCAACTTGGGCAACACATGCTTCATGAACTCTGCCCTGCAGTGTCTCAGTAATACACAGCCCTTGACACAGTACTTCACTAACAAGTGCCATTTATATGAACTCAACAGGACAAATCCCTTAGGTATGAAAGGTCACATTGCACGTCGTTACGGAGACCTTACTCAAGATTTGTGGAGTGGCAGCTCTCGCAGCCTGGCACCACTGAAACTGAGGTGGACAATAGGAAGATATGCACCTAGATTCAATGGATTTCAGCAACATGATTCTCAGGAATTCTTGTCATTTCTTTTGGATGGTTTACATGAGGATTTGAACAGAGTTCATTTCAAGCCTTATGTAGAACTCAAAGATAGTGATGGCAGACCAGATGAAGAAGTAGCACATGAGGCTTGGGATAACCACCTCAAGAGAAACCAGTCAGTTGTCGTGGACCTGTTTCAAGGCCAGCTCAAGTCTCAAGTCAGGTGTGTGGAGTGTGGTTATGTGAGTGTTAGGTTTGACCCATTCACGTTCCTCTCTTTACCTCTACCTATGGACAACTCCGTGCTTGTGGAAGTAATTGTTGTTCACCTTGAGGGTACAACCCCACAAAGTATGCTTCTCCTGGTCGAGATATTTGGAGCTTCTGTTAAGAGTCTACCATCGGACTTGCAGAAGATTCGTTCTGCTCTAGCCGGGGTACTTTACGCCTATGAAATCCCACTCCCTACAATAACTTGTGAGAATGAATGCAGCTCTTCCACTACTCCAAGTACAGAGGAGGAGAAAGTTGTATGTAACTCGTCTTGTACGGAGTCTGAGGAGCGATGCTGTGCTGCAAACCAAGATACAAACTGTCAAACAGCTGCAACCATTTGTAACAATGAATCGAACAGTGATGGGACTGAGAGAAAAGGAAGCAAATCTTCAGGAACAAACTCTGAAAACAGCTCGGAAGACAATGAAACCCGACTGCGAGTCAAAGAAGACTGGTTTGCGGAAGGAAAGAAGAACAAAAAGAAAGGTTCTTCAAGTCCAATTAAGAGATTGAGCCCAAAACTGCGGAAAAAAATAAGCCCTAAGTTTGGAGGGGGATTTAGCTTGACTGGAACATTGAAGAAGTCTTCGTCCTCCTCAATGGAATTAACTGAAGGACCTTTTACTTCCAATTCTGATTCTGGTATCAGTTTAAGTGTGGATAATTCTCCAAATCGTAAAACTCTTTCTGTACCTGGAAATGTGGAGGCTTGTTCCAGGAATTCTAGTCTTACTTCTACGCCAACAGCAGGACCTTCACCGTATTTGGGTTATTGTTTCAGTGGATTCATTGTTGCAATGCACAGGAAAACAATTCGTTTAGATGCATATTTTCTTTCACCGCAAAAGAACCGTCCTGGTTTATTTGGAATTCCTATCATTGTACCATGCTCCTCCAAAACAAGACAGTGTGAACTGTATGAGGGAGTCTGGACTCAAGTGTCCAGGCTGCTCAGTCCACCAGCACCAGGAGAAACGAATTGCAAGGATGGTGATGCTGGTGATTTTCCATTTGAGCTGCGGGCAGTTCAGAAGGACGGTCTCACATGCGCTTGGTGTCCGTGGTACAGATTCTGTCATGGTTGTGTGATAAAATGCAGTGAACAGGAGTTTGGCTGCAGTAGTTCGTACATAGCTGTTGAGTGGGATCCCACCACACTGCATCTCAGATATCAAAGCTCACAGGAGAAAGTGTCCACTGAACACGAAAGTGTGGAGAGAAGCAGAAAGCTACAAACAGAACCCATTGACTTGTATGAATGCTTTAGAGCATTTACTAAAGAGGAGGAGCTTGGAGAAGATGAGTTGTGGTACTGCAACAAATGCAAGAAACACAGATTAGCGTTAAAGAAGCTGGACATCTGGAGTTTACCTCCTATTCTGATTATCCACTTGAAGCGGTTTCAGTTTGTTAACGGCCACTGGGTGAAATCAAATAAGATTGTCCAGTTTCCCATGAAAGGTTTTGATCCTTCAGCGTTCCTGGCTAAGCGATGTTCGGGCTGGGGAATAATTCAAGTAACCATGGTAACTGTGGCTCAGGAGTTACCACAGTGA

Transcript

OS493_015857-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NFA0	Ubiquitin carboxyl-terminal hydrolase 32 OS=Homo sapiens OX=9606 GN=USP32 PE=1 SV=1
F8VPZ3	Ubiquitin carboxyl-terminal hydrolase 32 OS=Mus musculus OX=10090 GN=Usp32 PE=2 SV=1
M9PD06	Ubiquitin carboxyl-terminal hydrolase 32 OS=Drosophila melanogaster OX=7227 GN=Usp32 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003552 (this species only)
Ubiquitin family	DUB\|USP\|USP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00443 all species →	UCH	Ubiquitin carboxyl-terminal hydrolase	Family	Interproscan
PF13202 all species →	EF-hand_5	EF hand	Domain	Interproscan
PF06337 all species →	DUSP	DUSP domain	Domain	Interproscan
PF13499 all species →	EF-hand_7	EF-hand domain pair	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035927 all species →	Homologous_superfamily	DUSP-like superfamily	Interproscan
IPR006615 all species →	Domain	Peptidase C19, ubiquitin-specific peptidase, DUSP domain	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR028889 all species →	Domain	Ubiquitin specific protease domain	Interproscan
IPR001394 all species →	Domain	Peptidase C19, ubiquitin carboxyl-terminal hydrolase	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan
IPR018200 all species →	Conserved_site	Ubiquitin specific protease, conserved site	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR050185 all species →	Family	Ubiquitin carboxyl-terminal hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21646 all species →	UBIQUITIN CARBOXYL-TERMINAL HYDROLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004843 all species →	Molecular Function	cysteine-type deubiquitinase activity	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0016579 all species →	Biological Process	protein deubiquitination	Interproscan
GO:0005794 all species →	Cellular Component	Golgi apparatus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11837	USP6_32; ubiquitin carboxyl-terminal hydrolase 6/32	EC:3.4.19.12	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015857-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

45.0Max TPM

17.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.86	24.02
polyp at pH7 6	18	18	15.43	21.10
coral polyp · control treatment	16	16	21.18	45.02
coral polyp · oil and dispersant treatment	16	16	23.60	33.11
coral polyp · oil treatment	16	16	16.01	22.89
coral polyp · dispersant treatment	16	16	20.30	28.39
Polyp	10	10	7.17	13.06

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.02
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.53
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.31
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.04
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.20
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.16
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.49
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.24
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.04
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.84
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.10
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.61
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.56
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.83
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.41
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.79
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.60
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.10
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.66
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.66
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.62
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.89
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.17
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.48
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.99
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.14
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.40
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.52
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.39
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.53
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.54
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.77
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.90
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.16
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.78
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.29
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.45
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.32
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.20
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.98
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.72
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.21
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.42
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.01
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.38
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.31
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.15
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.57
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.11
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.58
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.05
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.02
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.17
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.03
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.81
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.68
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.97
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.46
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.46
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.92
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.18
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.86
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.89
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.53
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.70
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.52
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.21
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.28
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.85
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.38
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.24
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.44
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.49
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.40
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.71
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.65
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.54
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.39
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.06
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.79
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.13
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.40
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.26
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.72
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.14
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.02
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.98
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.88
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.66
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.06
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.01
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.06
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.32
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.77
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.98
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.17
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.16
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.04
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.21
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.72

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.