Gene detail

Detailed information of OS493_015888-T1 in Lophelia pertusa

Genomic Location: scaffold_48:1480994...1488123
NR annotation: KAJ7333797.1, hypothetical protein OS493_015888 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015888-T1

ATGGCCTTGCGACTGCACAACACAAGATTACTTGATGACGGTATCTGCTGTTTTAATTTTATCTTCGAAGATTTCTCCAGTGTTGGAGAGAATGTATATTCGAAGCCATTCTTCTTCGGTGGGTCTCGGTGGCGTTTACAAGGAGGAGTCAAGGGAGGGCAGTTTGGAATTTTTCTGCGATGGCTTGGCGGCGGAGATTACACTGACAAAGTCAAATGCAAGATTAGTTTTTCTGTGGAAATAATCAACAATAGAGATCCTTCAAAGTCCGTGAGGGCTGGAAATATGACTGACGGAGATGAGTTTCCAAAAGTGTCCTTCGGTATTGGCTGGAGCAAGTTAGTTCCTGTGGAAGAAATCGAGAAGCCTAACTCAGGCTTTTTGGATGACAATAATTTGTTTGTCGAGATCAAGTGCTCTATGGTACAGATTCTATTTGAAGATAAGTTGGTGATCAACGTAACATCCCGTACAAGCCATGTATCCAGCTCAAAGTTTTCTCTGTACGGTGAGGAATGGTATCTGGTGCTGTATCCCAAAGGTGAACCCAAGAAGAATAGCTCTGAGAACCAGCAGCAGGAACATGCCGCAGCATATCTACACAGAGAAGAACCTGGCATGTTAAGGTTCAAAGCCACCTACTCTATTTTCGTACGCGGCGGCCGTGAAGTCCAAGTAAGCCATCACTTCTGTAACAACAATGCTAGCATAGCATTTGGTATCGAGAAGTTCACCCGCACTAAAGATCTGAAGGCCATATCAAAAGGAGGAGTGGTGTCCATTGGAGTCAAAATCACAAGCATCGAGCCTTATTATTACTTTGGGTTTGACACAGAATGCTGGTCCCCTCCCAGTAACCTTGGAGACGGGTGCTCGATAAATAACGTGTTTCCTTTAGCTCTCAAGCCTAGCTCGAGTGACAAGAAAATGTTGGATTTCAACCTGGTGTTTGACCCAGGGCCCAAATGTGAACACGCTGAATTAGAAGACAGTGCTTATTACATGAAGATCCTTTGGAGTGTGAACGTGGTGTGTATTAAAGATCACAACAGAAGTGTCACTGTGAACTCGTGGGATGTTCCTGGTAGGAGTGCTTTCTGTTACAGCCAGGATGAAATGTCGATGAACACAACGCTAGAACTGAATGAGGTGTTGAACCCCTATAGTCCTTATTTGGATGACGAGAAACATTTGGGTGTTCGGTTGGTCATCACAAACGCCAATGAAGTTTATGATCCTCTTCTGATCAACTCAAACAAGCACAGCGTCGCAAAGTTGAGAGAAATGAATGCCCAGACAAAGGCTGCGGTGGAAAATTTCTGGAAGGACCAACTGGATGATGTGAACGCCGAGAAAGACAGAGTAATAGCTGACAAAGAGGAAGAGATTGCAGCTAAAGAGGAGGAACTTAACAAGAAAGAAGCAACAATCCAGGCGCTGGAGGAAGAGATCAGTGAGAGCAATGAATACCTTGCAGATATTGAGAGTACCGTTGATGAGATTGATGGAAAGAAGGTAAACAGCATAAAGGATCTCGTGCAAGAAGCTCAACCAGAAGAAGAGGAACTTGCTAAACAACAGGAAGTTGAAGAAAAATTAAAGGCTTTTTTGATGGAGCACCTCCAATTTAGCATCAGCCGCATATTAGTTGTCGGTGCTGCTGGACAGGGAACAACCATCAAAGGACACCAGGAACTAGACTTGGCTGTGTTTGTTAAAGATCTTCCACGGACAGAACATAAGAGTTGGTTACCAGCGATAGTGTTCACTATAAAGACCTTGCTGAAGCAAGAAGGCTGCAAACCAGTGGAGGACACAAAAGGCGATCAGCCCGCTAGCACACTGCCGCCATGTTCAGACTTCATGACGACTTCAACAGCTGTGTTGTTCAAGTGTGACGGTGTCAATGTGACGGTTATACCAGTTAATGACTGGGAGCCAATGGGTGGTTACAATGCTTTGTATAAACAATGCTTGGGACAGCCAGCAGATGCACAGTTATTCTATAACATATCAGTCTGTGAGAGACAAACAGAATTTATTTCACTGCAGAACGTAAAGTGTAAGGAGCTGATCCGCATTGTGAAGGTGTGGAGTAACAGTGTAGCATGGCGGAATTCCTCGTCCACGCCCAGTCAGTACCTACTGTGTCTACTGGTCGCTGCAGCTTATCAAGTTGTTAATGAGGGAGGTGATGAGTCCCAAGCAGTGATCAGAGCAGACAAAGATGTGTTCTTGGAACTTGCAGACATGGTTGGCGATGACTCACTAGAAGTGTTCTGGAATGAGTATTACCCATCAGAAGATTATGCCAGAGAGAATTTTCCAGTTCCGTTTGAGCTGCCGATTGTTCAAGACCCTGCCATTCCAACGCACAATGTGGCATCTGCTGGGCTGGAGGACTGGGCACAATTCAGGAGAGAACTATCAAAATGGGTTGCAAAATTGACACTTTAA

Transcript

OS493_015888-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002254 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10421 all species →	OAS1_C	2'-5'-oligoadenylate synthetase 1, domain 2, C-terminus	Domain	Interproscan
PF00917 all species →	MATH	MATH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002083 all species →	Domain	MATH/TRAF domain	Interproscan
IPR008974 all species →	Homologous_superfamily	TRAF-like	Interproscan
IPR018952 all species →	Domain	2'-5'-oligoadenylate synthetase 1, domain 2/C-terminal	Interproscan
IPR043519 all species →	Homologous_superfamily	Nucleotidyltransferase superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11258 all species →	2-5 OLIGOADENYLATE SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0001730 all species →	Molecular Function	2'-5'-oligoadenylate synthetase activity	Interproscan
GO:0003725 all species →	Molecular Function	double-stranded RNA binding	Interproscan
GO:0005654 all species →	Cellular Component	nucleoplasm	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0060700 all species →	Biological Process	regulation of ribonuclease activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_015888-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015888-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

44.1Max TPM

9.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.69	26.91
polyp at pH7 6	18	18	7.30	13.95
coral polyp · control treatment	16	16	12.15	32.20
coral polyp · oil and dispersant treatment	16	16	6.18	11.36
coral polyp · oil treatment	16	16	8.93	19.51
coral polyp · dispersant treatment	16	16	6.05	14.26
Polyp	10	10	15.79	44.09

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.91
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.52
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.58
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.15
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.63
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.52
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.88
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.79
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.37
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.19
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.45
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.94
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.54
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.28
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.52
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.95
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.77
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.88
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.18
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.74
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.57
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.30
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.77
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.17
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.01
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.80
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.79
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.16
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.14
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.14
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.78
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.20
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.08
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.58
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.74
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.78
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.54
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.72
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.45
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.27
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.61
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.68
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.59
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.76
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.88
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.48
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.36
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.81
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.61
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.06
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.95
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.92
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.87
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.05
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.94
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.70
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.40
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.06
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.69
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.56
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.51
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.64
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.13
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.59
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.57
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.44
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.13
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.67
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.39
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.01
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.63
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.23
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.92
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.26
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.45
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.80
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.76
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.39
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.66
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.62
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.54
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.46
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.40
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.02
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.87
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.83
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.84
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.36
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.57
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	44.09
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	20.75
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	20.29
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	17.91
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.39
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.25
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.07
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.68
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.99
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.44

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.