Gene detail

Detailed information of OS493_015938-T1 in Lophelia pertusa

Genomic Location: scaffold_48:1958819...1967036
NR annotation: KAJ7333846.1, Microprocessor complex subunit dgcr8 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_015938-T1

ATGCCGACTATTATAGCATCGAAAGCTATCGACCGAAAGAAAATAAGAGCTGTTTTCGAGAACAAGCTAATCTGGCCAAAAATGCAAAATGATACGGAGCAACTATGCACCAGTGGTTTGGATGGTTCGCGTCCCTCGTCAGCTCCAGCAACTGCTGAAGAATCGCTTGAAACAATGACGCTACAAGCAGGAAGAGTGCCGTTGAAAAGGAAGTCCGACGATGAACTGGGGAGCGACCCAAAGCGCCGGCCAGTGACAGAGGAAACTCCATGCAGCGAAGAAGCTAGTGCTACTTTGGCGCCGAATGATGTCACAGAAAATACAGGGACAGAGGAAGAAAACAGAGACGGAGGAAAAAACGAGCCCTTTGAACAAGAACGAAGAGTTATCATTATGAAGGGTAATCTTCCAAAATTAGCATTACCAGATGGCTGGATAGCGCTTAATCACCGAAGTGGTGGAATCATTTATCTTCATAAACCAACTAGAGTTTGCACGTGGTCTCGTCCTTATCACATTGGAGGTGGAAGTGTCAGGAAACATGATGTACCTGTGGCTGCCATTCCATGTCTTCATCAGAAAAGAGGATTGTCCATTGAAAAAGAGAAAATTCAAACTACAAGTTCAGAGAACAGCAGCTCCAGTTCCCTTCCAACAGCAAACCAGGGAGCGTCAATTTTAAATGCGATAAATATGGGTGAGAAGAATGCACCAGAGGGAACTCTAAATGAGGACGCCATTGCAGAAAGCGCGTCTGTTGAAGAAGGACGTGAAATAAGTGGACTGGATGTAATCATGAGCCTAACTGATACATTTGGCGTGACGGAGAAGGATGGCGTGACAGTTGACATGATGGAGAAGGATGGCGCGACAGTTGGCGTGACGGAGAAGGATAGCGTGACAGTTGGCGTGATGGAGAAGGATGGCGTGACATTTGACGTGATGGAGAAGAATGGCATGACAGTTGGCGTGATGGAGAAGGGTGGCGTGACAGTTGGCGTGATGGAGAAGGATGGCGTGACAGTTGGTGTGACGATGAAGAATGGCGTGACAGCAAGGAATGATGCGAGAGTTGTAAATGGTACGATGGAAATAGATGTTGTGACAGAAGGTAATGGTGTGACTGATAGATGTGATGTGACAGACCCAAATAACGTAACGCAACACTCACAAGTTGCAGAGAAGTCTATTTCTTGTAAAAAACAAGACAGTTCAGGAAAGGAGGCTGTTTCCAAAGAAGATCCCATTGGCAATGGTAGCACCTCAGACTTAGTAGCTGCTGGGGTACTGGGTACTTACCTGTCAGCTATATGGGAGTTTGAAGCTCTTACCTGTGATCAAGAACGGAATGCCGTGATCGCCCAACCACAACCTGTAGACACTCTGGAACTGCCGCCATCTTTGGAATGTCAGCCATACTCGGTGAAAGGCACAGAAAACGGGAAACAGCTACTAGCCGGCAAAGAGTGTTTGCTGAATGCTGGCGGGAAAACACCAGTGGCAATCTTACACGAATACTGTCAGCGGGTGATGAAGACAAAACCGGTCTATCTGTCCAGTGAATGTGAGAATGCGGACACGCCCTTTTTGGCCGAGGTGCAGATAGGTGAAATAAAATATGGGTCAGGAATCGGCTCGAGTAAGAAACTTGCCCGACAGATCGCTGCTGAAGGCACTCTGGAGGTGCTGTTGCCTGGTGTTTACAAGAAAGTACGTGATTACCAGATTTCAGAAGAAGAGATACAGTTTTTTGACAAAGTCGACATCTTGGATCCTCGGATTCCAGAGTTTTGTTCAAAGACAACCCTCCCCAATCCATCACAAATCCTCGAGGAGTGTTTAAAGAGAAACCAAGGCATTTGTTCATCTCCGATCCAGTTCACGACTCTATGCGGACAGGACAGAAGTCTGTCATTTCACATAACATGCGGCAAACACACAGCAACGGGTCCTTGTAAAAACAAACGCATTGGCAAGCAGCTCGCCTCACAACAAATCCTCAAGAAACTCCATCCTCATCTCGAAAAGTGGGGAGCGCTGATTCGAATCTACTGTGACAGACCTACGGGCTCGATAAAAAGTACAAGAAAGATGACAGTACATCTACCAGTGAGCGAGAAGAATACAGCTCCAATATGCTGCAGAATAAACGATTTGCTTGCGCGTCTCAAAAGCGAAATGAGAAAACTTCATTTTGAGGTCAAGCAAACGAAAAGAATGGACGGCACAAATAACACGACGAAGCCAGTGTTCACCGTGGATCTCTAA

Transcript

OS493_015938-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9EQM6	Microprocessor complex subunit DGCR8 OS=Mus musculus OX=10090 GN=Dgcr8 PE=1 SV=2
Q8WYQ5	Microprocessor complex subunit DGCR8 OS=Homo sapiens OX=9606 GN=DGCR8 PE=1 SV=1
A6QR44	Microprocessor complex subunit DGCR8 OS=Bos taurus OX=9913 GN=DGCR8 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005453 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00035 all species →	dsrm	Double-stranded RNA binding motif	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR040375 all species →	Family	Microprocessor complex subunit DGCR8	Interproscan
IPR001202 all species →	Domain	WW domain	Interproscan
IPR014720 all species →	Domain	Double-stranded RNA-binding domain	Interproscan
IPR036020 all species →	Homologous_superfamily	WW domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13482 all species →	MICRORNA PROCESSOR COMPLEX SUBUNIT DGCR8	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003725 all species →	Molecular Function	double-stranded RNA binding	Interproscan
GO:0020037 all species →	Molecular Function	heme binding	Interproscan
GO:0031053 all species →	Biological Process	primary miRNA processing	Interproscan
GO:0042802 all species →	Molecular Function	identical protein binding	Interproscan
GO:0070877 all species →	Cellular Component	microprocessor complex	Interproscan
GO:0070878 all species →	Molecular Function	primary miRNA binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18419	DCGR8; microprocessor complex subunit DGCR8	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_015938-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

31.5Max TPM

10.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.07	13.10
polyp at pH7 6	18	18	11.46	20.81
coral polyp · control treatment	16	16	11.15	16.78
coral polyp · oil and dispersant treatment	16	16	9.53	15.36
coral polyp · oil treatment	16	16	12.20	15.59
coral polyp · dispersant treatment	16	16	5.19	9.51
Polyp	10	10	15.36	31.50

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.10
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.06
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.56
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.01
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.95
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.71
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.53
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.48
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.90
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.79
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.72
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.24
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.07
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.07
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.92
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.89
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.84
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.38
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.81
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.96
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.32
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.14
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.92
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.83
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.71
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.91
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.44
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.07
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.13
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.03
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.66
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.50
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.19
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.47
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.07
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.14
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.78
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.57
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.42
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.44
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.01
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.22
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.74
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.60
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.43
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.85
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.75
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.75
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.54
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.86
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.71
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.36
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.36
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.14
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.35
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.79
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.75
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.71
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.69
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.61
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.03
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.02
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.63
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.11
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.68
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.83
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.59
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.05
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.33
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.66
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.36
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.06
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.73
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.59
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.61
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.25
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.88
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.85
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.64
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.39
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.51
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.20
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.77
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.71
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.69
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.10
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.05
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.65
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.57
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.17
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.66
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.42
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.09
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.37
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.23
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	31.50
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.37
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	17.13
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	16.59
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.39
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.34
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.83
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	12.39
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.38
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.72

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.