Gene detail

Detailed information of OS493_016060-T1 in Lophelia pertusa

Genomic Location: scaffold_49:464553...478952
NR annotation: KAJ7391773.1, Partitioning defective 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016060-T1

ATGAAGGTAACGGTGTGTTTTGACGCGGTTCGTGTGATTGTTCCGTGTGGAAATGGCGAACTCACAGTGTGTGAGCTAATCGAACGAGCGGTCTCCAGATATCGCAAAGCTACCAACAAGCCGCTCGATGAGTTCATTCAAGTACATTTTCTGGAGACCAGTGAAGATCATGGCATCCTCGATCCAGATGACATCCTTTGCGATGTAGTGGACGATAAAGACAAGTTATTGGCCATCTTCCAAGAAGGTTCCTCGCAGACGCTGCACCGTCCAGCACAAAATGGTGGATATGGAACAAGCTCATCTGTAGGAACGGCAAGTCCTGATCTATCTCAACACGAAGACGAGTCTTCAAAATTTATAGAGGAACCCCCTCTAAAACCATACATGTCAATCAACCATAAAGTTGAAAACACTAATGGCGAAATCAAAAGTGTATCCAGGATAACAAAGAGCCCGCCGCCGCCAGTTCCACCTAAACCTGTAAGACAAATCAGCGTGAACAGTAGTAGGACTTCATATATTGAATCTGTACCTTCGGAAGATTCTGGGATATCTTCGCATGATGACAGATTTCGAATCAGTTCGGATTCGTCAAAGTCTGAAACAATCGAGAATGTAGTCGTGAAGCCTACAATTTACAGGACAGGGGAAGCAACATTTGTTGCCATAGGGACGCCTGTTAAGGCTGCAGTATATAACGGTCATGGTCATGCAAACGTTGTTGACAGAAGACGATTTTCGTCAACAAGTTCTGATCATGCTGATAACGAACACAGCAACAGTGAGATGGAAGAAGAAACATTTTCATTGGGTCGAAATTCGACACGGAAATCTATGTTTGTAGACAGCCCTATGCTGGACAGATGGGCTGAACTACAGGAAGAGAGAATGTTTGTGGGTAATAATCATCAAGAACAACCAGTGCGTATTGTGACATCACCGTCACAGCCAAGCTCCAATGAACCGGACTTTGCTGTTAAATATCACCACGATGATCGGCATGATGATCGGCATGACGATCAGCATTCGGAAAGCTCGGAGAGTAGTGGGGAGCCTGACATGCTAATGATTGAGTTAAAGCGTGTGAATCCACTAGAACCATTAGGATTCACAGTGGCAGGGTATAGAACAGCTGACAGCAGGGAACTTGGTCTCATTGTTCGTAACATCTCACCTAGTGGCTGTGCAGCACGAGACAGAAGACTTCAGATCGCTGATAGGGTTGTTGAGGTAAATGGATGGAGTCTTATGGATATGCCAAATGAAAGAGCGGAGGAGCTGTTTGCTGCGGCTATCAAGGCACCAGTGGTAAACCTTGGTGTGTCGCGGTCACATTCATTCGTCCCAGGACAGAGCAGTGACGCACCACGTGAAGAGGAAATCGTGCAGGCTCGGCCTGCACTGGAAAATAACCAATCCCAACAGCAAGAACAATCACAGAGGGAAATATTGCCTTTAACGCCTCAGTCGCTCGTCGGTTCACCTTCCATTCCTGATAGCAGCTTCAAGAAAGTCAATAAGAGAATTCTTATTGAACTGATGAAGGGAAATGACGGACTTGGGTTTAGCATCACAACACGTGACAATCCAGCTGGAGGGAATACTCCCATATTCGTCAAGAGTATCTTGCCAAAAGGTGCAGCTATTGTAGGAGGGCAGTTAAAAGGTGGAGATCAAATCGTGGAGGTGAACGGACAGAAAATGAACGGCAAAAGCCAAGCCGAAGCCGTGAACGTGCTACGAAGCACCAGGGGTCTGGTGACGATTTTGGTACAAAGAGAAGAAGTGGTTCAATCGCCTCGGGCGCCTGCTATAGAAGTCAATGAAGACAGCATGCGTCATTTAAGAGAAGAAGGTCTCCAAGTGCTCAAATACAAAATTCCTTTGGACGTGGCTGGCGCGGCAGGCCTGGGCGTGAGTGTAAAAGGCAAGTCACGTGCCGTGACTGAACAAGGAAGAGACAGTCCCCAGGACAAAGGCATCTTTGTCAAGTCCATCATTCCGGGGGGAGCAGCAGCGAAGGATGGCCGTCTTTGCCCCGACGACCAGCTTCTCCGCGTGAACAGTAAATCGTTGGTCGGTTTGACAAACCAATCTGCCATGGAGAATCTGAGACTCGCTATGCAGTCTACAAGACCTAACCAAGCGTTCATAGATGTGACCATAGCACGAGAGCAAGACGAGACCGTCCCACCCCCCGGCGAGTTACTCCACAGTAAGTCCCTGGAGAAGCTAAATGCGCCTGATCAGGAGAGGCCCATAGAAGCGGGCTCCGAGGAGGGACCTGTGGAGGAGCCTCAGCGGGAGCGAGGTATCTCCGAGACTGACGGTGGTATTCTTCCGCATAAAGAGAGACACCCCAGCTATATAGAAGACCAATTTAACGAATCAATCACCAATAAAAATCTGACTCCTATTCGCGCGAGAAATGCTGTAAATCGTAACGACTCTTACTGCGTCGCCGTGAATAAAAGCCAAAGTCCTGGATCCCAGTTTTACAGCCCTTTTAGGCAACGTCCAATTCATCGTCCCAGTCCACTAGCCAAGGGAAATGACCGAGCACAACCTCTCGCGCCCAGCTCACTAGCAATGACGTCGACGCCAGTGGAAGGACGGTCACCTGTGCCAGCAGTGAACATTCCAGCGGGAAGACCCACTAGCACTGTTGCTATGCCAACGCCGCCTTTAGGGAGCACCGAAGAGAGGCCCTCGGGACCTGGTAGCCCTTCACACGCACCTGTAAAGCCACCGCCGCCTCAGCCCCCACCGAGATGGGACTCCGAAGCGGATGCATCTGCTGGGGCTAATTACGGTTTGCCAGCGGGGCTCCAATTAAGGCTCAAAATGCCATCAGACGTTCAAAGAGCTCACGAGGGAGGAATCAATACCTACAACTCACCTCCCAACACCCCACCTCCGCCCGCACAGTTTTCGAGCCAGTCACCCACGAAGGAGTACCCTCCCTCCTACGACCAGGCGGTGGCGCGCCTCGGGAGGTCTCCACACGCGTCAGTGAGCTCAGAACCTCCGACTCCAAGCCGAGAGCAGCGGAGATCATGGACTGAAGACAACGTGCCCCGCCCCGGGAGGTCCCCACACCCGTCCGTAAGCTCAGAACCGCCGACTCCAAGCAGAGAACAACGGAGATCTTGGACTGAAGATAACGTGCCCCGCCCCGGGAGGTCTCCACACCCGTCGGTAAGCTCAGAACCTCCGACTCCAAGCAGAGAACAACGGAAGTCATGGAGTGAAGAAAATGCTGCTGAAACTCCCATAATCGCTCCTCCCAGTCCTTTTTCCTCCGAACAAGAGGAGAATCCTTTTCTAAGAGACGGATTCGGGCGCCTGTCCATGTCGGAGAAACGAGGCCGAGCGGCACTGGACGCTAGACAGTCGGAGTACTTCATCAAACGAGACCAAGAGAAAAGTGAAAATAACTCTGAAGACGATGAGGTCGAAGAAGAACAACCTGAAATAACAACTAACCACCACCCCCTTAGAAAAGCGGACTCAGATGACAAGCTGCGACAGGCTTTCGAGGAAGATTCCAAAGAGGAAAGGCTGCCTTCTCCTTACGGTCGGATGCAAAAGAGTCGTTCAACTCCCCAGCTAAAACTTGTCGGACTCAAAAACGGCAAGGACAAGAAAAAAAATCAGAAGTCAAAAAGCAACGACAATCTGAGTTTTACTAGCGCCGTGGAAAATGCCAATCGCTCTTACCCAGGTGACGTACAGAATGGTCACGCAAGGTTTGGTCAGTCTGAAGATCAGGAAGTACCGATCACGATGAAGAGTAACGCGGATTTCACTGCAGTGCAACAGAAACTTGCTGTGAAGAAGCCTTTCTACAAAGGCATCAGTTCTGTGTTCAAGATCGGCAAAACCAGGCGCGGAGATTACAATCTGTCAGACAACGATGGCCCCGCGTTCAAACACACGTACAACAGAGAAGCACTCATCGACTTTCCTGCCGAGCAGAGGTACAGACAACTTGTCAATCACTACGGTCAAGAAAACCCTTCGGAGCGCGCCAACACGCTTCCTTCTCGAGGGCGAAAGAAACAGGAAGCCAGGGAAAAGGCACTCGAAGAAAAACGACCACCGCCGCAGACCATGAAAGTCGGGAGAGTGACGGTTACCGCGCCTACTAGGGTTTGA

Transcript

OS493_016060-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Z340	Partitioning defective 3 homolog OS=Rattus norvegicus OX=10116 GN=Pard3 PE=1 SV=1
Q99NH2	Partitioning defective 3 homolog OS=Mus musculus OX=10090 GN=Pard3 PE=1 SV=2
Q8TEW0	Partitioning defective 3 homolog OS=Homo sapiens OX=9606 GN=PARD3 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002915 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF12053 all species →	Par3_HAL_N_term	N-terminal of Par3 and HAL proteins	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR021922 all species →	Domain	Par3/HAL, N-terminal	Interproscan
IPR052213 all species →	Family	Partitioning defective 3 homolog	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16484 all species →	PARTITIONING DEFECTIVE 3 RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000226 all species →	Biological Process	microtubule cytoskeleton organization	Interproscan
GO:0005912 all species →	Cellular Component	adherens junction	Interproscan
GO:0005938 all species →	Cellular Component	cell cortex	Interproscan
GO:0007155 all species →	Biological Process	cell adhesion	Interproscan
GO:0008104 all species →	Biological Process	protein localization	Interproscan
GO:0016324 all species →	Cellular Component	apical plasma membrane	Interproscan
GO:0030010 all species →	Biological Process	establishment of cell polarity	Interproscan
GO:0035091 all species →	Molecular Function	phosphatidylinositol binding	Interproscan
GO:0043296 all species →	Cellular Component	apical junction complex	Interproscan
GO:0045197 all species →	Biological Process	establishment or maintenance of epithelial cell apical/basal polarity	Interproscan
GO:0051660 all species →	Biological Process	establishment of centrosome localization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_016060-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016060-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

200.9Max TPM

33.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	18.95	29.91
polyp at pH7 6	18	18	18.03	22.72
coral polyp · control treatment	16	16	27.95	49.53
coral polyp · oil and dispersant treatment	16	16	33.31	57.60
coral polyp · oil treatment	16	16	21.83	32.17
coral polyp · dispersant treatment	16	16	99.18	200.85
Polyp	10	10	12.55	18.07

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.91
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.73
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.44
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.21
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.19
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.26
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.45
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.42
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.39
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.35
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.86
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.07
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.62
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.94
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.60
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.07
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.48
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.72
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.39
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.32
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.16
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.30
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.73
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.37
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.25
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.63
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.25
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.55
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.25
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.20
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.55
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.63
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.05
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.53
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.87
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.88
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.95
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.68
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.59
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.21
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.31
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.40
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.31
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.02
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.09
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.08
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.70
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.47
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.60
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.59
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.52
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.04
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.05
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.24
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.11
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.91
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.53
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.60
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.60
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.59
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.03
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.96
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.45
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.17
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.00
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.78
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.19
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.71
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.76
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.43
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.86
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.43
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.62
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.81
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.78
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.71
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	200.85
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	164.25
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	149.84
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	125.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	112.22
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	102.34
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	100.96
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	97.52
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	96.82
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	96.68
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	92.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.82
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.38
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.01
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.12
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.82
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	18.07
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.40
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	14.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.13
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.43
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.84
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.24
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.91
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	9.22
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.95

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.