Gene detail

Detailed information of OS493_016130-T1 in Lophelia pertusa

Genomic Location: scaffold_49:1115553...1131353
NR annotation: KAJ7391840.1, Vacuolar protein sorting-associated protein 41 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016130-T1

ATGGCCGACATACAAGATCGAAACGACCTTGAAAAAAGACAGAAATCCGACGCAAATAACCCGGAAGAAGAAGATGAAGATGATGAGGATGATGAGGATGATGAAGATGACGGTGACGATGATGGTTCTTATGAGGAGGAGGATGAAGTGGAACCCAAGTTAAAATACGAAAGGGTCGGGAATGCTATGAATAACATTCTCAATGGAGAAGAGTGTGCTAGTTGTATGGCAGTGCATACGAAGTTTCTTGCTCTGGGAACTCACTATGGAGTTGTTCACATACTGGATCACCAAGGAAACCCGAGCAGCAGCAAAAAATACCCATCACATACTACAGCTATCAATCAAATTAGCATTGATCAGAGTGGAGACTATTTAGCCAGCTGCTCTGATGATGGGCGTGTTGTAATAAATGGCCTTTACAGTTCTGAGAATAATGTCCAAGCCAATTTTGACTCTCCTGTGAAGTCAGTAGCTTTAGATCCCGAGTTTTCCAAAAAAAGAACAAAGATGTATGTCACTGGTGGAACAAAGTTGATTTTGACAGAGAGAGGCTGGTTCAGAAACAAGGCGACTGTCTTACATGAAGGGGAAGGCAGTATCAGGACAATTAAATGGAGATCATCTAACATAGCATGGGCTAATGATGCAGAAGTCAAGGTGTTTGATATGAATTCTCAGCGAGTCATAACTCACATAAAAAGAGAGCCAGGAAACTACAGGCCTGAGCTGTATCGTTGCTGTTTATGTTGGAGAGATGACGTCACTCTTCTGATAGGCTGGGCAGACATGGTCCAGATTTGTGTCGTGAAAGAAAGATTGGTCCAAAGATCAGACCTTCCTCCGCTGGTTGTGGAAATAGTTGCCAGGTTTAAGACCGATTATTACATTTCTGGAATTGCATTCCTGAAAAATGACTTGGTCATCCTATCTTACATGACAAACATAGAGGCTGGTACAAGAAAGAAAGGAGAGCAGTTAATTGCACACAGACCACAGTTGAGGATTGTTACACCACGTGGCCTCAATGAACCCGAGGAGCTCAGTGCTGATGCTCTGTCAGTCCGAGGATTTGAGCAGTACCGCTGTGACGACTATCATTTAGAAAATGTTGCTGAGGAGAACTTGTTTTATATTGTTAGTCCTAAAGACCTTGTGCTGGCCAAGCCTAGAAACATTGATGATCACATCAAGTGGCTTATGGATCGTGGAAAATATGAGGAAGCGTTGGTTGCAGCAGAGACAAACAGTAAAGAGGTCAAGAAACACAATCACCAGGATATTGGAAGAGCTTATCTGAAATCTCTGATGGAGGATGGGAAATATGAGACAGCGGCCAGATTGTGCATAAAAGTCTTAAATGATGACAAGAAACTTTGGGAAGATGAAGTGTACAAGTTTGCCAGGAAACACCAATTGGAGGCTATTGCACCGTACATTCCAACAAGCACAGTGAAGCTGAGCTCAGCAATTTATGAAATGGTCTTGTATGACTTCCTCAAGAAGGACGATAAGAAATTTCAGGCACTGATCAAAGATTGGCCAGCGGACTTATACAGTGTGCAGCCCATTATTAGTGCTGTACAGGTGAGACCAGCTGGAAAAAGATCCCAAAACCGAGTTCTTCTGGAAACACTTGGAGAACTCTACACGCGGCTGAAGAGATATGACAAAGGACTAGCCATATATCTAAAGCTTGGCCACAGTGATGTGTTTAACTTGATCCATCAACACAACTTGTTCAATTCAATCCAGGACAAGATTATCATGTTAATGGAATTTGACAAAGAGAAAGCCGTGAAGATGTTGATTGACAATATAGACAAAGTTTCCGTTGAAGAAGTTGTACGTCAGCTGAACAAACGATCAGAACTTCTCCACGTGTATCTAGACACGCTGTTTGTGAAGGATCCACAAGCTGGAATGGATTACCACGAACTACAGATTCCTCTTTACGCGGAATTCGACCGTCCAAAACTGCTTACATTCCTGAGAAACAGCAACTATTATCCTCTCCAAAAGGCTTTAAACGAGTGTGAACAGAGACGTTTGGTTCCAGAGATGGTTTTTCTACTCAGTCGTATGGGAAACAACAAGCAAGCTTTGCAGCTGATAATTCAGGAGGAGAACGACGTGGAAAAGGCAATTGAATTCGCCAAGGAACAAGATGACGAGGAATTATGGGACGATCTTATTAATTATTCTTTAGACAAGCCAGAATTTATCACAGGTCTCTTGCAAAATATCGGAACGCATGTTGATCCTATCAAACTCATTAAGAGAATACCAGAAGGAATGAAGATTCCTGGTCTAAGAGATTCGCTAGTGAAGATCCTTCAAGATTTCAATTTACAGATCTCTCTTCGTGAAGGCTGTAAAAAGATTCTTGTCAAAGACAGTGTGTCGTTGCTGCAACGGCTGAGCAAAGTACAGCAGAAGGGCGTGTCTGTTGACGATGAAACAAAGTGTCCCGTATGCCAAGGAACCGTCATCGCGGAAGATACAAGAAGAGCGTCACATGTTGTGGTGTTTTTCTGTAAACACGTTTATCATGAAGACTGCCTACCGGCGCGTGACGTGGGTCCATTTTGCCAGATTTGCACGGCGCACAGTCAGGTGAAAAGACTGCGATCTCGACATGTGCAGAGGAATGAAACAAGACCTTAA

Transcript

OS493_016130-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E7F590	Vacuolar protein sorting-associated protein 41 homolog OS=Danio rerio OX=7955 GN=vps41 PE=1 SV=1
P49754	Vacuolar protein sorting-associated protein 41 homolog OS=Homo sapiens OX=9606 GN=VPS41 PE=1 SV=3
Q5KU39	Vacuolar protein sorting-associated protein 41 homolog OS=Mus musculus OX=10090 GN=Vps41 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004220 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10367 all species →	Vps39_2	Vacuolar sorting protein 39 domain 2	Domain	Interproscan
PF00637 all species →	Clathrin	Region in Clathrin and VPS	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR016902 all species →	Family	Vacuolar protein sorting-associated protein 41	Interproscan
IPR019453 all species →	Domain	Vacuolar sorting protein 39/Transforming growth factor beta receptor-associated domain 2	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR000547 all species →	Repeat	Clathrin, heavy chain/VPS, 7-fold repeat	Interproscan
IPR045111 all species →	Family	Vacuolar protein sorting-associated protein Vps41/Vps8	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12616 all species →	VACUOLAR PROTEIN SORTING VPS41	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0034058 all species →	Biological Process	endosomal vesicle fusion	Interproscan
GO:0046907 all species →	Biological Process	intracellular transport	Interproscan
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0016192 all species →	Biological Process	vesicle-mediated transport	Interproscan
GO:0005770 all species →	Cellular Component	late endosome	Interproscan
GO:0006623 all species →	Biological Process	protein targeting to vacuole	Interproscan
GO:0009267 all species →	Biological Process	cellular response to starvation	Interproscan
GO:0016236 all species →	Biological Process	macroautophagy	Interproscan
GO:0030897 all species →	Cellular Component	HOPS complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20184	VPS41; vacuolar protein sorting-associated protein 41	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016130-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

102.9Max TPM

37.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	36.09	59.88
polyp at pH7 6	18	18	36.33	58.39
coral polyp · control treatment	16	16	41.94	83.81
coral polyp · oil and dispersant treatment	16	16	37.42	84.56
coral polyp · oil treatment	16	16	46.09	102.91
coral polyp · dispersant treatment	16	16	23.52	43.09
Polyp	10	10	40.54	100.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.88
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	57.54
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.24
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.81
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.01
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.97
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.11
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.00
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.82
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.61
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.78
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.73
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.72
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.34
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.80
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.57
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.56
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.09
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.39
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.04
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.94
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.69
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.21
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.40
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.89
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.32
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.75
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.62
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.08
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.89
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.45
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.27
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.22
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.64
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.60
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	83.81
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.85
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.19
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.02
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.57
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.82
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.45
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.86
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.61
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.87
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.72
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.88
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.43
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.02
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.74
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	84.56
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.89
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.45
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.61
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.09
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.98
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.72
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.02
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.27
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.45
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.23
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.67
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.53
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.50
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	102.91
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	77.65
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	70.41
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.91
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.73
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.31
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.13
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.97
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.76
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.20
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.61
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.83
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.37
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.89
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.81
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.94
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.09
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.25
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.82
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.31
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.44
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.11
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.55
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.66
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.28
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.20
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.41
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.65
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.79
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.91
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	100.73
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	88.14
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	43.93
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	37.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	33.02
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	24.74
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	21.85
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	21.61
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	18.72
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	14.83

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.