Gene detail

Detailed information of OS493_016134-T1 in Lophelia pertusa

Genomic Location: scaffold_49:1155239...1159712
NR annotation: KAJ7391844.1, positive regulation of growth hormone receptor signaling pathway [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016134-T1

ATGTGGAGCTATTTTGACGCGACAAGCAACGCAACTATTACAGGCCCGAACAACAGCCGGCTGAGGTCGTTGGATCATGTGATTGAGTATCTCAAAACAGAGGGGACATGTAAATGTGGACTGGAGTGTCCCCTGTTTATTCACAAAGTGTTCAACTTTGATGCAAGAATTCCAAGCAAGTTAGTTCCAGTCAAGAGCAGGCCAGAACTGTCGCAGTCAGGCTGCAAACATTGCGTTATAGACTATTTAGACGTTTTAAACCCTCAGCAGCCATCAGAGATTGCAGTAAAGCAAGCTAATGATGCCAAGCTGCCGCCATTCTCTGCCGCACAGAAGAGAGGCCCAGGAAGACCTCGAAATCCCGTGTCCAAGTCACGGAAGGTTGGAGTTCGAAAGCCTGACCTGGACCGACCAACATCACCGCTTCACAACATCCCTTTACCTGTGCCAAGCTGCATCGCAAACAGTCCTGTACAGAGCGTGCCAACCAACATTGCTGTCGAGCAGGGACCTCTTCCGAGTTTCGCGACCATTGTGAGTAGTTCTAAACTCTTTAACCCCGGGGCAGGTCTGGGGAACACCATGCTGGCAAGCAGCAGTATCACAAGTGCAGTGAGCAGTGCCCCTTTAACAACGACATCACTGCAGTCATCAAAGACAACCGTCACTGCAAGCAGTGTTACCGTTACTTCATCAGCTTCTTTTACAAGCCCAGCGTCGACAGCACAGGCAGTGGCGGAGGTGTCAAAAACTACAGCTTCTGTTACGAGCTCAATGGTTGTCAGCCATCAGCGTGTGGCGGTAGTTCCAGCTTCATTGCCCTCGAGAAATCCACCACAAAGTGCTCTGGCAAAATGTTCCAGTTCACCAGGGATTGGTACAACAAGTGTTCCGTTGACTACTTCGGCACCAAGCATCAACAAACCTGGAAAAGAAACAGTTATATCAAATTCTACAGCATCAGTAGTGTCAACAAGTGTTACGACAATACCTGTCACAAAACAAGATGTGAGGTCAGTTGACAATGCAAGTAAGTTACCCAATGTCAAAGTGAGTTCTAAAGTGACGGTTCCTCGCAGCAAGTCAACAAAATCTTACGGACCCAGGAAAACCGTTGCGGCCACTCTTAAAGCTGCTGCCGCCACTGCAAAAGTGCCCACTGTATCGTCGGAAGCTGCAAGAGCAGGGATTGATAGTCCTCTTCAAAGACCTTATGTGGTGACGACTACCACTGCAACTGCTCTTTCCTCCGAGAAGGGAGCAGCTGTCAACAGCGTGAGTAAACTTTCGCCTCAAGTGTTAACTACACCATGTGTGTCGACAACTGTTCAAGCGCCTGCATTATTCCACAGTGTTCTGAAAGATGCCATCATAAAGGAACAGGGGCGTGTTGTTTCTTCACCAAGTACCACCACTGCCACAGTGACCAGTGCAGCACATCTGACGCCCAGTCATGGTTCAAGGAGCACTCAACCAGTTAATAGTGCTCCCTCTCACAGCAAATCTGGGGCAACCAAAGAAATTACACAGGCTACCACGGCATTAATTCAAGGTGTCAAGGCAAGCCATGTGCCACCAACTATACCCCAGCATGTACCGGCTCACAGACCTCAACTGCCAGTGACGGGGTACTCTCTTGTAAATGCAGGGGGTGGTTTCTGTGGTCAAGCATCTCTGGCCAACAGTACTGGTCAACAACAGAATGCCCAGGCTGGCACCGTGGCTCAAAGTGCAGTTCAACTACCACCATCGAGTATTTATGGACAGGTGCAGAATACAGTTGGGTCCTCGCAGATACCATCTCTGCAGATCGCGACTTCTCAAACACAGGGAGGCGTCTTCTTTCAAGGGAATGGAAATCAAGTATTTCAGATGAATGTGGATTCTAGCCAGCTGAAGGGAGCATATCAACTTCACGGCGCACTATACCAGGGCGCTATCCCAGCAACGTTTCTTGCCACGGCTAATGCAAGCAAGGCTGCACCATCTAATACCCCAGGAGGGATCGCTCAGGCTATGTACCCTACCAACCCTTATATGCTTGGTATAGTGATGCCTACTGCGATACCACAGCCAAACCAATCGGGTCAATCGGTGCCGACAACAGCAACATCTCCCTCAGCAGCTGTTGCTGCTGCTGCTTCAGTAGCTTCGTACTCCTACCCTACTCAAAATGCAGCAATCGCAGCAGCATTTGAGTCGTTTGTACCCATCGCTCCAGCTGCATCCCCAAGGTTTTCCCAGACATTGGCTCATTTGGCGAGTGCTTACACCCCATTTCTGCCTAGGGGTGCTGTTCAAGGAAGCCCCCCTGTCGCTCCTGTTGCCCCTGTCGCCCCTGTGCAATTTGCTGCTCAGAGGATGTTGCCGATGAACACCATGCATAACCAAGCGGGTGGAAATGGACAAATGGGGCCAACGGTATTGAACCTCGGAGACTATACTGTAAAATACCCAACAATAAACACAGTGAAACCTGGCTCGTATGGCTCTCAACCCTCCACTGTTAGTAACGTTGGACCAGCCAATACCCATCCTCAGACAGCTGTCGTTGCTGCGATGCCGTACGTTGCATTTGGTCAATTAAACCATCCCCGTTTTCCATTTTCTCTGAACTTTGCTTCTCCCGGAGTGAGTACAAATCCATCTGTTACATCATCCTCGTCATCACCGGCTTGCAGTTTTGTTACGTCAGCAACTACCCCTCACCAATACGGAGCTGGTGTTAATACAGATTCTCACAGCGCAGGTGCTGTGTTGGGGTATGTTGCCATGCCATTCAGTACTAACACCGGTGGTGCAAGTCACTCTTCGTCTTCTCCTAACCCTCTCCCCGGTAGTGCCTTTTCACCTCCTCCAGCCATGCCAGTGCAAGTCATGGTAATCAAAGGATGGATGTATCAGGACCGGTGGTCCAACACTTGCCGTCATGGTGCACAAACAAGAGTTTATCTGCGGCGGTAA

Transcript

OS493_016134-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B1AYB6	Methyl-CpG-binding domain protein 5 OS=Mus musculus OX=10090 GN=Mbd5 PE=2 SV=1
Q9P267	Methyl-CpG-binding domain protein 5 OS=Homo sapiens OX=9606 GN=MBD5 PE=1 SV=3
Q96DN6	Methyl-CpG-binding domain protein 6 OS=Homo sapiens OX=9606 GN=MBD6 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006077 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_016134-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

No InterPro signature was detected for OS493_016134-T1. This gene does have a gene model — the search simply returned no hit.

PANTHER

PANTHER term	Description	Source
PTHR16112 all species →	METHYL-CPG BINDING PROTEIN, DROSOPHILA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003682 all species →	Molecular Function	chromatin binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0010369 all species →	Cellular Component	chromocenter	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_016134-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016134-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

16.3Max TPM

6.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.72	12.04
polyp at pH7 6	18	18	6.46	9.41
coral polyp · control treatment	16	16	8.47	16.08
coral polyp · oil and dispersant treatment	16	16	7.50	16.31
coral polyp · oil treatment	16	16	6.56	11.35
coral polyp · dispersant treatment	16	16	4.36	9.11
Polyp	10	9	1.92	3.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.04
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.80
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.36
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.48
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.83
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.94
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.85
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.78
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.93
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.91
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.34
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.17
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.13
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.04
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.34
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.60
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.39
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.41
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.90
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.50
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.43
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.08
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.02
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.74
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.40
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.33
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.97
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.91
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.88
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.05
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.75
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.54
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.41
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.14
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.08
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.56
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.53
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.78
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.17
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.75
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.64
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.58
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.43
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.81
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.96
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.95
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.33
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.51
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.31
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.03
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.64
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.46
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.44
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.19
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.10
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.83
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.16
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.04
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.85
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.85
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.91
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.67
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.51
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.35
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.77
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.33
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.30
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.80
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.42
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.35
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.33
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.14
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.13
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.16
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.13
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.49
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.60
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.56
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.54
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.14
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.58
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.97
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.46
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.26
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.16
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.13
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.05
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.70
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.11
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.37
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.33
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.69
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.51
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.51
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.84
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.64
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.62
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.41
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.39
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.55
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.