Gene detail

Detailed information of OS493_016187-T1 in Lophelia pertusa

Genomic Location: scaffold_49:1608980...1616256
NR annotation: KAJ7391891.1, hypothetical protein OS493_016187 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016187-T1

ATGGGCTGCTTGACCAATGTGGAATTCACACCTAAAAACCAAAACGACTTGATGATCAAATTTCTCGACAAAGGTGTTGCTGATGCTGTGAACGTCAACATGGACAAGGAATGCCCATCATTGTCCACCTTCGAACCGTACACATTTTCCAGACAAGACTCCAGCTTCACTTTTGCAGTTGTGAAGAAGGATGCAATGACTGGCAGCTTCAAGTTCCGAACGTACAAGAAAGTTGGAGAGGTCTTGAAGCAAACGAACGGAGACAACGGTTTTTTGATATCCTACAGGGAACGCTACATGGCATTAAAAGTGACAATTGGTGGTAAAGACACAGTTGTGTCCCTCTCTTACACTGAAAACGAGCCAAAGGTTAACAGTGGGAACTGGCACGTTGTCGAGTTTAGTATCGGTGCTTCATCTTTCTCGTTGACAGTTGACACGAAAGCACCAGTCACAAAAGCTCCGGCGGTAGCTTTCCCAAGTGATTTTTTCAGTGCCGAGGCAGTAGCTGGGGGTTTTACTGGTTGTATGCGAGACCTGACAATCAATGCCCAAGATAAGAAACCGGTCAAGGGGGTTTCCAATATTAAAAATGTGGAGACTGAAAGCTGTAACATCACCGACCTGTGCATCTTCTCGCCCTGCTTGCATAAAGGCGGTTGTTCTCAAGATGGAAAGTCTTTTGAATGTGATTGTACTGGCGTAGGATACAAAGGGCCAGTGTGCCAACAGCCTGAGTTCCTGTCAAACTGTGAGCAATTGAAAAAGAAATTGGTAACAGGAGGTAATCGTAATCCTTCAGATAGAAATTACACCCTGGATATTGATGGCCCAGGTCCGATCAAGGCTAGCTCTAAAATTTACTGTAATATGACGGCAGATCCTGCCATCACAGGCGTTTACAGCCAACATCAAGGAATCAAGATCATCACTAATAACAATGAGATTGCCAAAGCCTTGGCCATGAACAGTGGAAACTGTAAGCAGTACATCGAGTTTGGCTGCAAAAATGCCAAACTGCTTAATGCCGGTGGAGGTGACAAAACAGGCTATTGGGTATCTGCCGATGGGGTGTACCAAAAATACTGGGGGGGTGCTCCGCCTAATTCCGAATCGTGTGCTTGTGGCGTGGATAAAACTTGTGACCCGGATAAAAGTTTGAAATGCAACTGCGATGCTAGACAAAACATCTGGACTAAAGATGCAGGATTGCTGACAGCGACAGCAGACCTGCCTGTTACACAAGTGGTGTTTCATGACGTCAATCCTCTCAAGTCTTCAGAAGCTAACTTTACTGTTGGCAACCTTTACTGTTCTGGTAACATCAGCAATACGGCAACATTTGTAAATGAAGATGGCATGATTAGACTTTCCAAATGGCCTGAGCCTTCTGCTGGCGTTATATCACTCTTCTTCAAAACGCCTTATCCTAGAGGAACAATACTGTACAACGGTAACTTGATGAAGGATTACTTCTGGTTGGAGATCGTCAATGACACCAGTATCAGCCTCAAGTATAACATCGGCAACGGCCAACAGAGGATTGAGCTGAGTTTGCCAGACAACAAGAAAATGACTGTCGGGTCGCACAAGGTGGTTATTTACCGCAATATGATGGAGTGGGTGCTGGAGCTGGATACCGTAAAAGGCGTGAATAAAAACCCCTTGTTCTTGAAAAAAGATTTAGATCTGGAGAATGACTTGTATGTTGGAGGTTACCCATATGAAGTGGAGAAAGGACTTGTGGGGTGCATTCGTGGACTGACTATCAATGGTGTTGTCATTAATTTGAATAAGAAGGCAGCTAATGCAGAATACGTGCGAGGCGGCTGCGGTGCAGCATGTGAGAAGCATCACTGTAAGCTGGGCGGTAAATGTGTCGATAACTACAATGTCTACAAATGTGACTGCAGTCTGACTCCATTTTATGGCTTCTTTTGCTCGCTAGATAAGGGTGCGTCCTTCAGTGAGCCAAAAAGTCAGTTAACGTACACATTCCCTACTGCTGCTACTGTTCCCGGAGTGGACATTGTAGTTGGTTTCAAGGCAAAATCCGAGGATAGCTGTGGAGGTGACATAATCCGAATCACCAGCAAAACGGATAATGATTTTTTCCTGCTTTCGCTCAATCCTTCCAACAAGAAACTCAAGTTTTCCTACAGAGGCTTTGGAGGTGATGGTTCCTTTGAGATTGACCCTCCAGTCAGCTCTTTCTGTGATGGGAACAGGCACACGTTTGCATTGAGTCGCCGAAATGACCAAGTCAATTATACAGTTGATGGAATAAGTAAGCTACCTTTTAAACAAGATCGGCTGGGAACACCCTTCAAATCTATGGAGAAATTAATGATTGGAAAGGAAGGTTCTACTGGGTTCAAGGGCTGCATTACAGGTGTAAAAGTCACAAGGGTTGACTTTGGCAAGACATATCCCACAGTTGAACCAATCAAGACATGTCTCTATGATGGTGTTACCGAGGGATGTTCAGCGTCAGGCCTCAGCAGTGACAGCAAAACCAAATGTGGCGAGGAGCCAGAGGTGCCTGAAGAGGCACCCACAGCTCGAGTTGTTGGTACTCGTGCTCCTGGCAGCACTGGACCTCCTGCAGATCCGACAGCTGGTCAGCGCAAGGAGGATAACAAGACGGCCATTATTGTCATTGTAGTGCTTATCCTGGTCCTTCTACTGGTAGTGTTGGTAATCGTCATCTACTGGTACTGGGCGCGTCACAAGGGAGAGTATCATACCCACGAGGACGACGATGAACTCAAGAGCGCCGATCCCTACATTGACATGACCACGCCCAAGAAAACGCTAGGCGAGGAGACGGAGAAGAAAAAAGAATGGTACATTTAA

Transcript

OS493_016187-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B8UU78	EGF and laminin G domain-containing protein (Fragment) OS=Acropora millepora OX=45264 PE=1 SV=1
Q9CPW0	Contactin-associated protein-like 2 OS=Mus musculus OX=10090 GN=Cntnap2 PE=1 SV=2
Q9UHC6	Contactin-associated protein-like 2 OS=Homo sapiens OX=9606 GN=CNTNAP2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000572 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02210 all species →	Laminin_G_2	Laminin G domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001791 all species →	Domain	Laminin G domain	Interproscan
IPR000152 all species →	PTM	EGF-type aspartate/asparagine hydroxylation site	Interproscan
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR003585 all species →	Domain	Neurexin/syndecan/glycophorin C	Interproscan
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan
IPR050372 all species →	Family	Neurexin-related cell adhesion and synaptic protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15036 all species →	PIKACHURIN-LIKE PROTEIN	Interproscan

Gene Ontology

No Gene Ontology signature was recorded for OS493_016187-T1 in Lophelia pertusa.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K07380	CNTNAP2; contactin associated protein-like 2	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016187-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

125.3Max TPM

54.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	46.87	60.16
polyp at pH7 6	18	18	50.59	91.69
coral polyp · control treatment	16	16	68.64	120.36
coral polyp · oil and dispersant treatment	16	16	59.38	116.21
coral polyp · oil treatment	16	16	60.54	125.34
coral polyp · dispersant treatment	16	16	65.39	104.59
Polyp	10	10	19.50	29.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	60.16
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	60.10
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.35
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.19
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.04
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.67
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.24
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.14
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.52
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.63
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.12
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.44
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.95
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.84
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.31
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.64
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.33
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	91.69
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	86.08
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	73.49
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	71.20
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.39
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.19
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.65
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.14
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	53.75
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.87
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.43
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.39
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.56
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.82
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.13
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.86
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.03
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.91
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	120.36
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	118.51
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	101.36
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	99.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	98.21
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	70.14
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.34
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.18
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.19
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.82
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.26
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.64
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.35
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.72
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.23
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.67
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	116.21
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	98.76
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	89.52
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.00
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.50
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	72.42
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.29
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.79
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.77
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.68
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.59
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.19
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.99
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.77
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.85
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.84
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	125.34
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.83
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	86.93
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	86.00
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	75.82
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	70.12
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.38
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.29
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.54
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.34
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.20
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.60
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.42
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.65
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.10
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	104.59
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	96.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	93.59
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	91.31
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	88.88
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.34
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	82.23
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.81
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.44
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.91
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.16
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.62
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.51
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.89
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.53
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.75
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	29.91
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	28.94
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	26.66
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	24.29
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	23.60
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	17.15
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	16.41
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	10.65
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.67

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.