Gene detail

Detailed information of OS493_016402-T1 in Lophelia pertusa

Genomic Location: scaffold_50:977027...991608
NR annotation: KAJ7385326.1, hypothetical protein OS493_016402 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016402-T1

ATGATTACGACGACGCAAGAACTAGCCGTGACCGTCACTCCTCGAAACAGAGCCAACTTTCGACGGCTTAAAACTAACAGTATACAAAGCGTAAAACGATGGGAAAAAGAGAACGAGCTTCTTTATGCCATGATGGAGGACGAAAGCGAGTGGTTAGCCAAGCTATTTCCCGACGTGGTTATTTCTCCGGAGTTTTTCTTCTACGCTTTGGAAGATGGATCGCTACTGTGTCGACTTGCGAACTACATTCAAGAGAAAGCGGAGTTGTACTCTCAGAAGCAAAACGTCCCAGTGCCCGGAAAGAAATTTCGCTATCACACCATGAGCAAGTGCGGCAGAGAGATCAAACTTTTTCGATCCAGGGAAAATGTGCAACAGTTTCTCACATGGTGCCGAAGTCACGGTATTCCCGAAGCCATACTGTTCGAATCGAACGATGTTGTGCAAGTTGACGAGTACAGAGAGGGCTGCCGAGGTGTCATTATCTGTCTTATGGAAATTGTTAGAAAGACAGCAAAGTTTGAACTTGATGAACTGCCGCAGTTGATTCGAATGGAGAAAGAAATCGAAGAAGACGAGGCACAGGGCGACACGGAACTTTCGAACGGGCAGGGGCAAATTTTGGACGTGGAGCAGATAAACAACATGACTGATGAAATTGACAACCTTGAAGTTCAACAGACAGATCAACCAGAAATCCAAAGCCCTAGTTCATTAGACTCGGATTCTGGGGTGGAGTCTGTATTTGATCAGGAAGAAGGGGAAAATTCGGCTTCTCGTCTTACGGAGTTTAATGTGGATGAAACCGAGGATGCAAGGAAAACCACAGCCGTGACAAGAAAACAAACTTCGTCGAAACCAAAAGATCAGAAAAGTTCTCCAAAGAGTCGAACTAAAACAAAAGAACTTCCTTCTCTACTGGAGAGCACCGGGCCCAAGTCCGAATTAGATAAACAGATTTGCAAGCTTGCTCAAGACTACAACATAAAAATTGTTCATCGTCTGAAAGAAGGAAAGTACATCATTCTTGGCCGAATCATGTTTGTTCGGATGCTGAATGATCACATGTTGGTGCGAATTGGTGGCGGTTGGGATACGCTGGAACATTACCTAATGACTCATGCACCTTCTAAACAAGCTGTTGACAACTCAAGTACTCCAAATTCTCAAGTTGTTGCCAGTCCACGGAACTCGATATCAGCAGGCTCTGGGCACAGGAGTAGTCTGTTCGACAAGATTAAAAGGAAAGAGCAGATTGGAATTATCAGAGATTCGCAAGTTTATTCCTCGCAAGGAAGTTTGAATCAGCTATCGAGAGCGCAATCCTCCCCGAAGCTGAAAGACTGCAGAACGAAAAAGGTCTCCGTCACTGAGAAGGACGAGAAGGACATCTCAGACGCGATCCGTAAAATCGAGTCGTCCCTATCACAGAACTTATCCACAAGACCCGTGAGCTTTACTAGCAAGACTTTTCACCAGCTTAAAAGTCGTTTTGATAAAGGAATATTCGGGACGAGTAGGCGAACCTCATCCCCCGATCTTTCGTTAAAAGGCAAAAAGATTTCAAGGCGTTCGAGTGATATTCCTACCATGGCAGACATTGCTACTGTTCTTACTTTTGATGGAGTGAACGAAGATCAGCATCAGACTGCCAATAACAATGATTCCGACTTGAAACAATCCGAGTCTGGAGAAGCTGAAGAAGCGGTATTAGTAAAAGTTACGGCACCAAGCGAAGACTTACTAGGAGACGAAACTTTGCAGAAAGATCATGTTTTACAACCCGAACATGCTTCGGACGAGATTGACGGCTCCGCGCCCGGTGGAGATCTCCCCTCCATGGTTCACGCAAATGAGTCTAACTGGACTGACGATTTGTTAGGTGGTCCAGTGAACGGGAGCGAAAATTACGCTGCGCCTCAAGGGGCAAATCTTGTCGATATCTCGTCGTTTGATCCATTCGCAGCAGCGCCTGACCAGGGCGAACTTATTTCGATTGATAGTGCACCTTCGGAAAACATCGAGGAGCAGCCGAACACCACCGAAGTTACCGATAACGGCCATGTGGCTGACGATGGACAGTCTGGTTTAGAGAGTGCTCCTGAGGCTGTCTCCGAAACAACAGAGATGCAGGATGGGTTTGAACAATTCACACCTGAGCCGGAAGAAAGTGCGGAAGAGTCTTTGCCTCCGATTGATCTGGGAGATCTACTAGCGGATACAGAAAATGCTGTGGAATCTTCACCGCCGGTTATTCTAGAAGATTTATTACCCGACACAGAGTCGAGTGAACTTACAGAAACTAAGGCAGAAGGAGAGTCAATCGAGTCTTCATCTACAATTGTTCAAGAAGACGCGACAATCCCGGAAGCGCAGCCAGCTGACGTTACAGAAGAAGTAGTTACGAATTCCTTTGAAGAAGTCCACTCGACAGAAGAAGTCAAACCTGATGAACCGACAGAACAAGTCAAACCTGACGAACCTGTCTTGAATGAGGACGTTCAAGATGTTCCTCCCATTGTAGTAGATCTTGTTGTGGAAACGAAAGAAGACACGGCCAAAGTAGATGAGCCCGTTCCCAGCGAGGAAGCTGTGGTTAAGTCGGAAGGAGAAAGTCCTGAAGCTGCTCCCGTGTTGGAAGAGACTACCACGCAGAAACAGAGCCAGGAAGACATTGTTACAGTAGTCGAAAGTGTTTCAGTTATACTGGACGAGAGCAAGGAAGAAGTAACGGAGGAGACTACCACGCAGGAACAGAGCCAGGAAGAAATTGTTACGGTAGTCGAGAGTGTTTCAGTTAAAGTGGAAGAGAGCAAGGAAGAAGCTGCGCCTGCAGATGAAGAACCCAAACAAGCGGAAGAAGAAGCGAAGCCTGTAGAGGAAGAAGGCAAGCCAACAGGGGAAGAAGTCAAACCTCTGGAAGATGTCAAGCCTGTAGAAGAAGCGAAGCCTGCAGAGGAAGAAGTCAAGCCTGCAGAAGATGCCAAGCCTGTAGAAGAAGTCAAGCCTACAGAAGAAGCCAAGCCTACAGGGGAAGAAGCCAAGCCTGTAGAAGAAGTCAAACATGCAGAGGAAAAAGCCACGCCTGCAGAGGGACAAGCTCCAAAGACAGAGAAGCAGGCTGGAAAGGTTGCAAAAACGAAGCCTCAATCAGCTGGTACAAGAGCTAAATCTACTCCTAAAGCAGCACCCTCGGCGGCAAAACCAACCGGAACTAAAAAACCAACAGGAGCCGCAAAGCCGACTTCACCTACAAAGGCGCCCTCCACTGCGGCGACCAAAAAAGACGTCAAAGCTCCGGCTACCAAAGCACCAGCTACCAAGCCTTCTGCTAAAGTGCCAGCCACGAAGACTACAACCTCAACGGCTCCTGGCGCTAAGAAACCCGCAACTAAAACTCCAGTAACGAAGACAGATGAGGTAAAGAAACCAGAGAGGCCAAAGAGTGCTGTAACAGCTCGCCCTCCAACGAAACCCAGCGCTCCCGGTGCGGCTCGACCAGCCAGTGTGGCACCCAAGAAACCTCCGACCTCAACCACTAAACCCTCTGCCGCTAAGGCGCCTGGTAAAGACGTGAAGGACGCTGGTGCACCAAAAAGCGCGCCAAAGACCACAGCTTCTCGGCCAGCATCCGCCAAACCAACACCTTTGAAAACAAGCGCTCCTGCAAACAAGCCCACTGCAGCTAAGCCAGGCCGACCTCAGAGCGCAAAGCCTAGCGACAGTGCTAACGGTGCAGCCAAGAAACTTGCTGCGCGACCGCAAAGTGCGAAACCAAAACCAACGACTACAACCACCACCGTGAAAAAGACAACAACGACCACTACCACCAAGAGTGGTGCCGCCCCTGCTAAGACTACTACCACGAAAACTGTCACGCAAGTCAAGAACGGTCCAGCCAAAACTACCATGACAACCACTAAAAAAGAAACGACAAGGCCTACCTCGGCTGCTGCTAAAACCGCTGCTGGTGCTAAGCCCACGGCGACTGGCGCGAAATCAAAACTTGGCGGGAAACCAAGCGCGGGAACTGCAAGTGGAAAACCATCGACGAAAGCTGCGCCTAAGAAAAAGGCGCAAGAGCCGGCGAAAGAAAAACAGGACGAAAAACCAGCAGTTCAGCCAGTGAACGTTAGAGGACTCGCCAGTGCGTTCGACGAAAAGCCTTCGGAAGTTGTCGAGGGTGTAACTGACGAGAAGCCTGCCGAAGTTGTCGAATCTGTTTCAGAAGAACGACCAGTCGAAGCGAGCCCCGAAGAGAAATCGATTGAATTAACGCCCGAATCAGCTCCAGCCGAACAAGCTACCGAGCCAGCCGAAGTCTCTCCGGAAGGCGTTGAATACGAATCGGATGTCGTCACACAGATCGTCACGAGCCAAACGACGACTATTATCGCAGACGGTGAAGAACAGTCAAGTACTACTACGACAGAAGAAACTACATTTGAACAGGCTGTGGGAGAAAGTTGA

Transcript

OS493_016402-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9W3Y4	GAS2-like protein pickled eggs OS=Drosophila melanogaster OX=7227 GN=pigs PE=2 SV=2
O43903	Growth arrest-specific protein 2 OS=Homo sapiens OX=9606 GN=GAS2 PE=1 SV=1
P11862	Growth arrest-specific protein 2 OS=Mus musculus OX=10090 GN=Gas2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001140 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02187 all species →	GAS2	Growth-Arrest-Specific Protein 2 Domain	Family	Interproscan
PF00307 all species →	CH	Calponin homology (CH) domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036534 all species →	Homologous_superfamily	GAR domain superfamily	Interproscan
IPR036872 all species →	Homologous_superfamily	CH domain superfamily	Interproscan
IPR003108 all species →	Domain	GAR domain	Interproscan
IPR001715 all species →	Domain	Calponin homology domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46756 all species →	TRANSGELIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0001578 all species →	Biological Process	microtubule bundle formation	Interproscan
GO:0001725 all species →	Cellular Component	stress fiber	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005884 all species →	Cellular Component	actin filament	Interproscan
GO:0008093 all species →	Molecular Function	cytoskeletal anchor activity	Interproscan
GO:0031110 all species →	Biological Process	regulation of microtubule polymerization or depolymerization	Interproscan
GO:0035371 all species →	Cellular Component	microtubule plus-end	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan
GO:0051764 all species →	Biological Process	actin crosslink formation	Interproscan
GO:1904825 all species →	Biological Process	protein localization to microtubule plus-end	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_016402-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016402-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

115.5Max TPM

44.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	35.35	57.28
polyp at pH7 6	18	18	31.04	41.20
coral polyp · control treatment	16	16	52.87	90.77
coral polyp · oil and dispersant treatment	16	16	66.33	113.18
coral polyp · oil treatment	16	16	39.19	57.83
coral polyp · dispersant treatment	16	16	57.31	115.48
Polyp	10	10	19.59	31.29

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	57.28
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.48
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.64
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.42
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.23
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.85
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.82
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.61
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.11
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.89
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.75
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.94
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.58
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.69
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.73
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.08
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.18
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.96
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.20
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.74
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.85
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.62
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.94
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.50
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.09
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.20
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.95
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.03
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.60
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.72
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.21
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.07
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.99
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.68
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.83
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.54
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	90.77
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	87.88
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	75.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.20
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.69
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.90
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.28
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.64
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.30
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.63
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.57
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.50
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.86
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.40
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.29
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.95
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	113.18
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	97.49
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	85.84
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	85.34
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	83.26
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.20
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	71.76
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.88
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.37
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.52
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.85
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.57
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.45
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.01
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.09
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.49
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.83
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.03
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.27
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.26
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.47
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.33
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.06
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.23
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.97
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.70
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.59
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.30
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.48
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.93
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.90
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	115.48
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	86.51
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.08
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.64
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.48
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.14
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.83
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.72
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.42
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.77
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.53
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.28
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.38
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.04
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.16
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	31.29
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	30.92
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	25.82
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	25.52
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	19.83
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	16.90
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	14.80
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.80
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	9.59
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.47

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.