Gene detail

Detailed information of OS493_016702-T1 in Lophelia pertusa

Genomic Location: scaffold_52:35252...47148
NR annotation: KAJ7372783.1, Methylcytosine dioxygenase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016702-T1

ATGGAAAGCAGTGGCGTTGAGCGACCTAGAACGCCGGCAAGTCGAAGCGAGCCGGGTGAAAAGCGATCTGGCGATTTTGAAGACGTTGTGCCTCGAAAGAAGCGGCGAAGATGTGGCGGATGCGAGCCATGTCTGAGGAAAGTGAATTGCGGGGAGTGCAGCAATTGTGTCAATAGAAAAACTGGTCACCAGATATGCAAGTTCCGTAAATGTATTGAGCTAAGAAAGAAAACGTCAAACAGCATTGCGAAAGACAGCGTTCAGCTGCGACCGGGTGACGATAATGAAGACGAAGACGCAACGGAACAACCCTCGCGTCGCGTGAGTTTAGGAATCGAAGAATCCGATAAGCGAGCCAGCGACGAAGTCGCGGAAAACGAGATTATCGCCGATTCAGAGCCTGCCGAATCTAAACCGCAGAAACCAGAATCACCAGGGATAATTCACGTGCAAGAAAGCGTTGAAGCTCCTCAGCTGAAGGACACAGAAGAAATCAACGCGACAGTCGAGCACCCCAAAGATGTTCGTGTGAATATAACAGCGAGAGGTGAATTTCAACTCGCTCGTCCAACCGAACCGAGCGCTGAAAAGCTTTTGACGAGCAGCAAGGTAGTGGTTTCCCGCAGTGAAAGCGATTTTGAACCCCCTCCATGCAACTGCCCAGTTTCAGGAAAAGATGACAGTCCCTATTACACGTACCTGGGTTCAGCACCAAACTTGGCTACACTTAGGAATATCTTAGAAGATAGGTTTGGTGTCAAAGGATCATCTCTTAGAATCGAACTGATTGGTTTCACCGGGAAGGAGGGGAAAAATCACCTTGGTTGCCCAATAGCGAGATGGGTTCTTCGTCGATCGGGCGAAGAGGAGAAGATCCTGGTAATAGCAAGGATACGTGCTGATCACGTGTGTGACACGTCACTGACTGTGGTGAATATTGTATTATGGGAAGGCCTTGGGAAAGAGCGCGCAGATTATCTTTACAAGGAACTCAGTACAGTGTTGCCTCAACATGGCGTACCTACAGCAAGACGATGCGGCATCAATGAAACTAAATCGTGTGGCTGTCAGGGGATGAGTGATGACACTTGTGGCGCGTCCTTCTCGTTTGGCTGTTCTTGGAGCATGTACTATAACGGCTGCAAGTTCACTCGAAGCAGAACGCCGCGGAAATTTAAATTGCTCGATCCCTCTAAGGAGGAGGAATTAGAAAAAATGATGCACGGTTTAGCAGCTGATGTATCCTTTGTATACGAAAAGGTTGCACCACAAGCCTTCGATAACCAGGTAAGGCAAGAAAAAGAGGGCCTCGAGTGCCGCATTGGGCACAACGACCAGCGGCCATTTTCTGGTGTCACGTGTTGTATGGATTTCTGTGCGCACAGCCATAAGGACTCCAGGAACATGGACGGTGGAGCAACACTGGTCTGTACGCTTCTGAGGCCCAACTCTAATAACCCGGAAGATGAACAGCTTCACGTGCTACCATTGTACCGCTTACTGGACAAGGATGGGTCGCCTGTGGTGCCAAATTACGTCATGCCAAGTCATTTTATTGACCCCCCTATGGGAATATCTCCTGGCTACTCTACGGTCACAGGGCAAGAAAATTCTCCAAAAGGAAGCAAAGCAGCGAACAGCCAAGACCAACACCTTAAAGGAGAACGTAAAGAGCTCTTTCAAGATCTTAACAACAACCACCAGCAGTTCCTCCCATACGGACATGCGCACGGGCATGCGCAGTCAGTGCACGGGTTTCCTAATTCGGTGATACACCACCATCCCGCGTCTAACCACGTGATGAACAACTGTTATAACGGACACTACCCCCCTCAGGGCTCACCGTTGTTCCAGTTTCACCCTCACCTTCAGAACAACTACGTTCTGAACCACTGTCGCGCGCCCGAGGTACACTGGGTAGACGAAAACCACATTCCATATTTGTATCGAAATCCAGGACACTTGAACCACTTTCACAACTCCGGCACTAATTATGATAATTATGAAAATTATGATCGTAAGGTTCCCTTCGTGGGATCGCCGCCGTGGAACTGTCGGATGCCCTTCGGTAAGTCGTCGTTTGCAATGAGCAGCGCGCCGTCCACCCGAGGCGCGGAGTACGCCAAACCGAAGGCGGTTATTCATCACTACAATGGCGCCTCGAATGACGTCATAAGAGGGCCTTCTCAGATCAAATGGGTAGACGATAAAGAGATTCCGCTCATGAGGGCCTCGAACAATGTTCCAATGGACGAAAATGCTAATGTAAAGGGGGAGGTAGAAAATCGCAAAAGTGGTGGCAAAGATTTTGTCAACACGGAACAGCCACGCAAACCGTTTCAGATCGAAGAGAATATGGGCGGAGTAGCCATCGCTCTTAGCCATGGCTCCTTGCTCATTGAGGTCGCCAAGAAAGAACTGCATGCAACGACCCCCCTGAAGAACCCGACACGACAGGATCCCACCCGCATCAGCCTCGTGTTTTATCAACACAAGCACATGAATCTGACGCTTCATGGCTTGGGTGAGTGGGAGGAGAAGGTGGCTAGGAAGAAACTGGAGGGGGAAGCAGCCAGTATGGAGGCAGATGCCGCCGAGAAGGAAGCCTCTGCTGACCCAAAAGTGGAAGAGCAGGAGGTGGGTTACCTCGACATGCTGGCGGAGACAGCTTTGTCCCGAGCCGACATAACTCCTGGTGCTGCCAACAGGCATGATTCGAATGCGCCTTATTCTGCTGAACTAGCATCGGTGAATGCCAGTGTTGTAAACCAAAATGGCGTGCACGATCCATCGTCTACTACAGATTCATCAGATCGTTTGCCATCCACTCCGATGCAACAAGTGAACAAAGCAATGCTGTATCACGAATTCTCAAGAGGACCTAACCACATTAACGCTTCTAAATTTCTACCAGTTCACGAGATGAACGAGCGCAGTGTGCGGGATACTAGGGAAGAGATGCTATCTAAATTGTCTCCTCCAAAAACAGAACAAAATAACCGGGTTCACAAGCCAATTGAGTTAGGCCCAGTAGGGCCCCGTCAGGAGCCGTTGTGGATGAATGCTCTGGGCACCTCTCAAAATAGCACCTCTCAAATCAAGGAGCTTTCTCCAAACACGCGGCAACAAAGTTGTGGATCTTTTCTTCCGAACAGCGGAGGCCAAGAAGGCACAATATTGCCTGGTAAGGTCTCTGCGAGTGAGGGAAGCATGTTAGCATCAAACCAGGGTTTTCCTGTACAAAACGCTGTTACAACCCACATAGAACCATCATCGCACGGCGAAGGACTTAAAAGCTTCTCTGCTCCAAACGGAATAATCCCCGAGAGAATTATTAACAACTCGCACGCGATGAAATTAGGTTCCTATAAAGATATTACCGCTGAACCGTACGCGAGCAAGCTGCGCGAGACGCCGCGCGAGACGCCGCGTGGGGAACGCGTCAACACTGGTTCGAACTTCAGTGTCTCGAGGCTTTTAGGAGACGGAAACAACAAAGAGAGCAAACCCAGCAGCGCTTCTTCATCGTCGTACAGAATAAGCAGCCTTCTCGCCGACGAGAAAACAGTGTCACGCGCGCAAGATGAAAGTAACGTAGATAAGATTCGTCAACCCATTTCTCAGGTGCAAGCGCGCTCATCTGATAATGCCCCTGATGTCACCACGAGGCACCATCTTGTTTCAGACCCTCCGTTGCAAGGACCAAGTGTCCCTGCGTCGCAACCAAGATTTCCATTCATGCCGCCATTCCCGCATTCCGCCCCAAACAGAGACAAACTTTCAGCTGGTCCTGAAAGATCATATCTTGACCTCTCAATGGCGGCCAATCGCTTGTTCTCTGGTTACAGTCCGTACAAGTTTAGCGTCCCGTTTCCGACCTATCCGAGCTTTTTTATGCCGCCATTCCATCCGCTTCTCGCATCAGGAAACGGTCTCTCGTCGAACCTTGCGTTAGTTAATTCTCAAAACTATTTGTCTTCCTTTATGGATAATTCTAAACGGATCGGAGACACGAATGGTATGGCGGTTGATCCAGCATCACTGACCACCATATCCACCGCTACACGGACTGGAGTCAGTTATCCCATAGACACGCTTATCACTGTAGCGCCGTATACACAGACGTGTGTCACAGGACATTACCAAAACTGGCTCTGA

Transcript

OS493_016702-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6N021	Methylcytosine dioxygenase TET2 OS=Homo sapiens OX=9606 GN=TET2 PE=1 SV=3
Q3URK3	Methylcytosine dioxygenase TET1 OS=Mus musculus OX=10090 GN=Tet1 PE=1 SV=3
Q8NFU7	Methylcytosine dioxygenase TET1 OS=Homo sapiens OX=9606 GN=TET1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005310 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12851 all species →	Tet_JBP	Oxygenase domain of the 2OGFeDO superfamily	Domain	Interproscan
PF02008 all species →	zf-CXXC	CXXC zinc finger domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR040175 all species →	Family	Methylcytosine dioxygenase TET1/2/3	Interproscan
IPR002857 all species →	Domain	Zinc finger, CXXC-type	Interproscan
IPR024779 all species →	Domain	2OGFeDO JBP1/TET, oxygenase domain	Interproscan
IPR046942 all species →	Domain	Methylcytosine dioxygenase TET1-3, oxygenase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23358 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006211 all species →	Biological Process	obsolete 5-methylcytosine catabolic process	Interproscan
GO:0045944 all species →	Biological Process	positive regulation of transcription by RNA polymerase II	Interproscan
GO:0070579 all species →	Molecular Function	5-methylcytosine dioxygenase activity	Interproscan
GO:0080111 all species →	Biological Process	obsolete DNA demethylation	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24309	TET2_3; methylcytosine dioxygenase TET2/3	EC:1.14.11.80	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016702-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

16.9Max TPM

5.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.49	12.62
polyp at pH7 6	18	18	5.49	9.15
coral polyp · control treatment	16	16	6.51	10.67
coral polyp · oil and dispersant treatment	16	16	4.58	8.01
coral polyp · oil treatment	16	16	7.58	15.55
coral polyp · dispersant treatment	16	16	6.41	16.93
Polyp	10	10	2.66	4.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.62
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.10
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.67
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.48
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.28
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.80
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.59
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.42
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.56
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.85
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.67
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.53
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.51
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.36
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.21
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.20
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.77
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.24
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.15
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.04
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.23
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.68
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.63
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.32
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.17
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.70
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.28
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.27
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.96
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.92
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.48
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.93
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.28
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.27
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.67
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.41
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.28
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.93
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.08
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.98
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.69
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.29
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.87
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.87
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.04
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.83
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.90
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.95
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.51
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.08
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.50
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.17
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.64
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.48
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.12
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.18
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.13
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.13
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.83
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.81
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.62
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.55
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.61
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.15
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.69
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.80
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.73
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.77
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.73
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.07
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.61
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.46
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.40
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.74
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.83
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.93
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.39
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.56
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.40
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.68
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.66
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.21
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.51
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.97
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.60
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.00
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.82
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.37
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.03
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.49
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.73
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.97
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.79
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.22
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.79
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.60
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.34
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.82
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.98
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.38

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.