Gene detail

Detailed information of OS493_016716-T1 in Lophelia pertusa

Genomic Location: scaffold_52:156693...168694
NR annotation: KAJ7372797.1, hypothetical protein OS493_016716 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016716-T1

ATGCCGAAATACGGTGCGAAGACATATGGTCGAAATCGCGCCAGAGAAACGAAAATTTCCAAGGAATTTGACGAGATTCAAAAAAGTGAAAATTCGAAAGCAGACGCCGTTACATCGGAAAATACGTTCACAAGACGACTTACAAGAAAATCTCCATGGGCCAGAACAAGTAGAATTGTTGAAAGCAATGCTAGCTCGATAAAGGAAGCAGCCGTTGATTCATCAAAGACAAACAAAAGGAGAAAATTGGAAGTCATCGAGGAGAAAGACCCGTTTGCCTTCGATGAAGATGACGTGACAGTCTCGAGTTCCCAGAGAAGTACATTTCGAAGTAACGCCACCGCACAACCAAAACAAACATCAGCGACAGAATTGACTGATAAAAGCACTGACGATGAAGCTTACAGCAGCTCTCAAGAATTAAGCGAAAATTCGTCACAAGGCCGAGAAAAGAAGATCGGCAATAAGCTAACTGCGTCACCGTTTAAGAGTTTTTTGAAGAACAATAACAAGTCTTTGTCACCAAAGAAAGACAAATCATCAAGAAGACTCTCGGCTTTGCCAACAACAAGCGCAGACATCAGTGAGGACTCGCTGGATGAGGCATCCCCAGATGTTCCAAATCTTATCCCTGTTAAATCTTGGCCCCGGAGAAAGGAAGAAGATTCTTCCAGTGTTGTGAGAGTAAAGAGAACAGATAAACCGCTGTTTACTGTTGTACAGAATGTCAAACAAGTTCATGAATGCTTGGAGTCTGGGGAGGACCAGCAGTTCCTTGATGATGTGGAGTACCTCCTAGATGGTCTCAAACAAACCCGTTCAATATCGACCCGGTGCCTTAGTGCTCTGGATTTTGCGTCCCATTGCTCTCAGCCCTCGTTCAGAGTGAGCTTTAGGGCCCATGGCATTGCACCCAAAATGTTTTCAGCCCTTCAAGATGCACCTTCAGATAAGTGCCTTGCGCTTTGTACATCAGCGATTACTCTGATGTTGTCGCAAGACCGTCAAAATGCTGACTTAGACCGATCTGTTCTTGCAAACAACCAGCAATCCCAGTTGTTAAAGGATTATAATAAATATGTCTCTAAAGTAAGAACTTTACTAGAAAAACAATTTAAAAGAGGATCTGATGAACTACTTGCAGCAGGCGATGATGCCATCAATCCTGCATCTCTAGTATGTGAGTCAATGCTGTCTTTGACGTCCCAGAGGACCGGGGAGTGGTTCAAAGAAGAGATCAGAGTACTGCGAGGATTGGATCACATTATGGACACAGCAATTCAAACTATCGACAACCTTCTAACAAGATACGCTGATGCCAGATTACATGAGGGTGTATCAACAGCTAAGCTGAAGAAGATGACGAGATGCATGAGACTGCTGGAGAATGTTACAATCCAGAATGCTGCTAATCAAGAGTACATGGTTCATTATGAGAAGGGATCATTTGTGACTGCTCTGGTTAGGTTGTTACAATTGTGTTTGAACACACTCAACAATGGTATTTCGCCAAAGGAAGCTAAGAAAAAACCAGATGAGGCATATGAAGACTGTTTCTTTAGCATTCTTAAAGTTTTCCTGAATCTGACGCACAATTTTGAGGCAGGCAGCTCTTGTATTGGACAGCAGGACGGCTTTCTTTCATCACTTCTGTTGACTGTCTTGCAGTTGCCACAGTTTGTTACAGAGAGCAAGAGGTTTGACTTACTTGTGCTGAGCTTGGAACTCTTAATTAACCTTGTGGAGGACAGTAAACAGAACATTGCTTCCCTGGTGCAGATACGCACACCCCCCTGCCATGAGAGTCAAGACAGTAGCCAAGAAGGGGACGACCAGGGGGGGCAACTCAGCTCAATTGAGGCTCTTGTGCAGCTGTTCCTGATTAGAGAACAAGCCGCTAGGAATACGGATGAGATGACTTCAGGTTTATCAACTGAAGAGGAAAGTAGTCAGGAATCATTTAAACCAACCAAGGATGGCATGGGGTGGATATGCGGAGAGGACATTGATGTTTCTGTTGACGAAGGAAATAAGAAAGCTGCAGAATTGCAAGAGGAAGAAGAAGAAGAAGAACCGCTGGAGGTACAACTTGGAAAAGCTTTACAGAAGGCAGGAAAGCACATGGAGGACAGTGTTGTGGCTGCGTATGTTGCAATACTGCTTGGATGCATACTACAGGAGAATGAGGCAAACCAGTGCTTTGTTCGTGGTCTTCTACCAGATGGTGATTTTTCACTACTTGTCAATGTCTTGAGAAAATTTCTTCGCTTCATTAAACTCACAAGTGGTACAAGTGGACATGCCATTGAAAAGATTGTTAAAGTATTGGAAAGTTGCCAGTGA

Transcript

OS493_016716-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7Z5K2	Wings apart-like protein homolog OS=Homo sapiens OX=9606 GN=WAPL PE=1 SV=1
Q65Z40	Wings apart-like protein homolog OS=Mus musculus OX=10090 GN=Wapl PE=1 SV=2
Q9W517	Protein wings apart-like OS=Drosophila melanogaster OX=7227 GN=wapl PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004572 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07814 all species →	WAPL	Wings apart-like protein regulation of heterochromatin	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR022771 all species →	Domain	Wings apart-like protein, C-terminal	Interproscan
IPR039874 all species →	Family	Wings apart-like protein	Interproscan
IPR012502 all species →	Domain	WAPL domain	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22100 all species →	WINGS APART-LIKE PROTEIN HOMOLOG	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0071922 all species →	Biological Process	obsolete regulation of cohesin loading	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25163	WAPL; wings apart-like protein	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016716-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

24.6Max TPM

7.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.95	11.35
polyp at pH7 6	18	18	7.55	10.99
coral polyp · control treatment	16	16	9.92	24.63
coral polyp · oil and dispersant treatment	16	16	5.53	12.86
coral polyp · oil treatment	16	16	8.87	12.98
coral polyp · dispersant treatment	16	16	6.36	13.87
Polyp	10	9	4.69	11.37

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.35
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.18
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.94
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.31
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.87
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.79
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.73
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.54
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.36
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.90
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.05
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.57
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.20
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.11
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.88
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.77
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.48
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.99
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.84
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.76
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.42
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.35
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.83
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.72
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.44
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.20
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.89
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.86
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.71
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.63
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.09
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.60
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.15
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.63
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.59
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.87
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.10
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.64
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.27
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.23
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.03
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.64
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.54
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.15
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.31
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.60
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.48
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.05
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.86
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.48
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.56
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.44
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.87
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.65
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.22
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.83
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.79
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.56
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.88
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.21
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.53
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.49
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.16
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.98
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.91
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.90
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.71
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.10
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.13
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.70
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.23
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.88
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.86
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.43
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.86
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.00
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.56
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.87
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.07
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.08
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.93
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.57
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.09
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.61
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.16
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.57
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.18
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.87
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.39
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.10
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.46
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.23
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.64
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.37
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.60
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.38
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.36
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.05
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.90
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.39
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.40
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.