Gene detail

Detailed information of OS493_016785-T1 in Lophelia pertusa

Genomic Location: scaffold_52:1622363...1650732
NR annotation: KAJ7372859.1, hypothetical protein OS493_016785 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016785-T1

ATGTTTTCTTTGCTTAGTCAAGGATATGGAACCTATGACGGAACAGCGAAGAAAGATGCACAAGAAAGGCAAGAACACAAGGATTACTTCTCGCTGGAGGACGTTCATCTGCCACCCATTGGATCAAACTACAGGCCTCCAGAACAAACAGAGGTCCCTGATGACCACATTGGACCAACATACGAAAACAAACTCTTTAAACTGCCTAAAGTGGACAACATAAAGCAGAATCTTATTAGTGTACCGAAAACCTACACAACAAGAAAAGGTGCATTACTTCTGTATGCAGAGGACTTTTTCTTGCCAGGCTCTCCAAAACCCAAAAAGCGGCGCTGTAAATTGAGGAAGCAGCCATCAGTAAAGCTTAAAACAATTGGTGATTTAAGGAACTACATATTGGACTACAGCAATGGGGGTGATCCACTCTTTCTTGCATTGCTTCAGAAACGGTTGAGTGGTTACAAAGACCAGTCTGTGAGACCAGGCTTTTCACCAAAGCGTTACATTGCTAATCTTGGTAATTCACTGGAAGAAAAGACGTGGAATCGATTAGCTGCAACAGGATCTCTTAAGGATCCAACATTACTGACCTATAACCCCAAAGATACTTCAGTGCACAGGGATGGTGCAGTATGCAGTCTATTTCCTGATAAACCACAACCGTACAGTACAATGTCACTGCCTCCTTTTTCTCCATCAAGCTCAATGTTTGAAAGCTCATTTCATTTTTACAAGAATGGGATGTCAACTGGAGCTGCATCAATGATCTCTTTGAACAGTGAAACTGAAGAATATGCCCCATCTTCAAGGGCACTAAGTCCAGAAGAATCATTGAGTAATCGGCTTTCAGAAGTTGAGTTCCTACCCCAGAGAAAAGACTTCTATACCCAGTTAAATGCCAAACAGAAAGAGGATCTCATATCTCAACTTCTGCTCCAGAAAACTTTAGAATCTATTAATTCTGATCTGTCAGACCTTCAGGGATGGGTGGCTAACTACCCAAACAATGTAGGAGGGGTAGAAATCGAACAGGATTCAGCATTTGTAGTAAATTTGCCGAAGAGTAAATCCAAGCACAGAGGAAGCCTGAAATCAGGCTCTTTAACATCAATACCACGTTTACCACCCATACAGTCTGCAGGTGCTCAACCATCAACCCCGGTGGAATTAAAAGAAGAGTCACCTTTACCACAGCTATCAACTGAAGTGTCAGTTCATCAACAAAGAGAGTTTGCATCTGGCAAAGAAGAAACTGGCAACATTCTTGATCCTGGTTCTATACATGTAGACTTAATGAGTTCTTTGGATGAAAGTTCTTTGTCAGGTTATCAAACAGATTTACCACAAGGAGATGAAGATATTATTAATTCTGAAGAGGTGGTCAAGGGTGATGATAGTGAATTGCATGAAGATCAAACTAAACATGCAAGTCAATTTCCAATCAATGAGAAAAGTCAAGAAACCAAACATTTGGATGATGTTCAAGGAGATGAAACAGAGGAACTTGACATGTGTTCTGACTCTGAAGAGTCAATATCAAATCAAGGCATAGTGCAGAATGATGCAGTGATAGGACTTGATGACATCATACTTAGCGAGGATACTATTCGGGAAAATGAACATCACAGAAGTCAGGATGAGGAGATGAAAGGTGTTACAGCAGAAAGAGCAGATAGAGAAGAAGTCGAAAGAATATATCAAAATTACAGTGAGCCACAGGGACAGGTGGAAGAAGCCAAATTACATCCTTCAGAAACAGAATCTGATGGTGAAGATGAAGGAATTGGTCTTGATGGAAATGAACTTGATGGTATTAATAGAAGAGGAGAAGAATTAATAGAGGAGCAGGAGGAATTAAATCAAGCTGCTGACAGGACAGCCATCATGGAAGAAGGTTCCCAGTCTACCCATCAAGTTCAGCCTCCTCCTCCCATAAGCTTGGAAGAACTGCAGGGTGAGGCACATACTGTGGCCAATAGAGTTCTCAGCCGTCCTCAGTCTGGAATGGTATTCATGGAAGATGTAAGGAGTGCCATTGCAATGTGGGCAGATCGCTTAACAAACCTCCTTGGACCTCCCAAACAAGATGCACGTGTGAGTTCTGCCAGCCATCAGAGATCTCAGTTAACAGGCCTTGCTGCTCAAAGAGGGTCAAATCGCCTCACAAGGCATCGTAAAGTGAGCCGGTCGGCGGGTCCTTCTCTACCGGCTCTACGGAAAGCTTTGAAGATTTCTGGAGAAGAAATGCCGGAAATAGAAGCATTACGAAACTTGCCGCCACTTCCGGAGAGATTCTACAGGCCTGGGCAAGCACAGCCACCCAGTGGAGGTGCTAATGAACACACATACCACGAGAAACTCAAAAATGGCTCCGCTACAACCAAAGGATCTAGTGCGTCTGGTGCTGCTGGCTCAATTTCCTGGGAGCGTGTTTCCAATGCTGATGTGAAAGTTGATATTTTTAGTTATGCCAAAAAAGATAAAGAGCCGAGCTTTGAGAGAATACAAGCCAATGAGATCGATGATGTAGAATCAGAAGAAGAGGATGAAGAATTCAAAAGAGCTTTAAGTGCTGTAGTAACAGAAGTCCAGCAGGACTATACCCTAATAGAAGCAAAGTCAAGAATGGAGCTCTCATCTCCCAACAAATTGCAAAAGCCATTTCAGTTTCCCCGCCCAGAAGCATCGAAGCCGCCTGCTGGTCTACAAAACAAAAAATCGTCAGGACAAGTGAAAGGGAAAGCTAAGGTTGGGCCACCAAAAAGAGCGGTTGCAGGAAAAAAGAAGGCAGGCAAGAAACCGGCAAAACAACAATCAAAACCTTCAAATAAATCTGCGAAATCTAGTGAAGGGAAAGTAGAGACACAAAACAAAGACAATCACCAGGAAATAGCGAATGATGTTAACGAAACGACAATAACGGGAGAAGACAAGCCTGAACCTGTTAGAGTTGACTCAGAAACAGGTGAACATGAACCTGGAACATCAGATAGAACTGTTGTCTCTTCTGCTCTTTCCAGAGTTACCTCATCCAGAGTTTCCTCTAAAGCATCTGATGAGTTCAATGAAAGCAAGAATGATTTACCCTCAGACAGTAGCGCGACTCCAGTTCCTGAATTCCCATTTCTCATCCCTAAACCTCCTGAGCCACAAACTATTCAACAGGAACCAGAAATAGAGCAGGCGCCAGAACCAGTGGAGCAGAAACCAGTACAGGAGTCCAAAGCAGCTAGGAGGGCAGCGGAACGAGCTGCTGCTGCAGAAAGAAGACGTCAAGAGGTGGAACGCAAGAGAAGGGAGAGGGAAGAAGCCAAGAAGCGAGCCATTGAGGAGGAGACCAGATTAGAACAGTTAAGGCTTGAGGCAGAAGAAGACATGAAGAAGAGGGAGGAGGAACGAAGACAAAGACGTCAAGAAAAGGAAGAAGCCAAACAGCGTGAATACGATGACGAGCTAGAGCAGGAACGGCTGGCCAACATGAAAGCTGAACGAGAATGCCGTGCGAGAGAAGACTGGAAGAAACGCCAACAGCAAGTGTTAGCGTACAGAAAACTGGAGGAGGACATGCGTAAAGAGCAAGAGAAGATAGAGGCCGAACTGGAGGCAGCACGGCTCAGAGAGGAGGAAGAACGAATAAAAGCCATGGAGGAATCAGAGAGGGTGGTATTCCTCGAGAAACTGCGTCGCGAAGAAGAAGAGTTGAGGCGAAAACTCGAAGAAGAGAAGCGAAAAGAAGAAGAACAGAGGAGAGTTCGAGAAGTGGAGAGAAGACAACGGGAAGAGGCTCTCGCATTACTGCGGCAAAAGCAACTGCAAAGACATTTATTTATCGCTGGAATCTTAAAAGAAAGTCATTATCTTTCATTATGCCAGCGACTAACGAAGGCATTTACATTTTCATATTTTGATCTTATTCCATGGAATCATTTACAACACTTGAAACCACCACCTTCGCCTGTCCGCGACCTTCTTCGTTCAGTAAAGGAGAACATTCCTCCGACTATTGTGGAGGAAGACGAAGTAACAGAGGATTAA

Transcript

OS493_016785-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A7YY35	Uncharacterized protein KIAA2012 homolog OS=Bos taurus OX=9913 GN=KIAA2012 PE=2 SV=2
Q0VF49	Uncharacterized protein KIAA2012 OS=Homo sapiens OX=9606 GN=KIAA2012 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008281 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15709 all species →	DUF4670	Domain of unknown function (DUF4670)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR031440 all species →	Family	Protein of unknown function DUF4670	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21937 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

No Gene Ontology signature was recorded for OS493_016785-T1 in Lophelia pertusa.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_016785-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016785-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

96.9Max TPM

26.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.04	24.93
polyp at pH7 6	18	18	13.94	16.97
coral polyp · control treatment	16	16	38.40	96.95
coral polyp · oil and dispersant treatment	16	16	35.16	86.69
coral polyp · oil treatment	16	16	39.87	77.11
coral polyp · dispersant treatment	16	16	26.55	43.64
Polyp	10	10	11.89	20.36

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.93
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.45
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.27
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.36
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.46
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.07
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.64
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.53
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.27
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.11
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.07
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.60
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.56
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.51
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.37
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.32
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.36
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.85
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.97
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.55
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.20
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.18
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.64
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.35
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.20
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.74
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.63
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.50
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.97
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.61
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.76
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.70
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.67
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.33
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.75
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.18
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	96.95
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	84.66
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.56
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.93
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.42
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.44
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.63
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.66
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.08
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.61
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.48
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.84
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.12
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.70
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.69
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.61
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	86.69
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.12
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.68
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.13
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.55
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.81
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.54
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.94
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.02
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.38
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.32
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.73
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.21
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.08
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.03
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.29
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	77.11
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	70.32
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.40
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.14
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.82
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.19
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.33
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.30
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.47
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.87
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.73
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.06
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.45
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.03
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.02
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.60
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.64
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.54
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.20
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.60
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.23
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.91
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.16
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.87
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.97
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.75
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.42
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.02
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.08
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.58
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.41
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.40
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	20.36
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	15.35
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.65
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.45
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.89
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.75
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.74
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.32
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.21
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.18

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.