Gene detail

Detailed information of OS493_016981-T1 in Lophelia pertusa

Genomic Location: scaffold_53:1751200...1766193
NR annotation: KAJ7360349.1, hamartin [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016981-T1

ATGAACGCAGCCACGGAAAGCTTAGCGCTGCCGAGTCAGGGAGAGTTTTCCCTGTTCGATCTCGATGCAGATAACATAAAGACTGTAGAAAAAACTAAAGCTCGGATTCACGAAAATCTCCACTCGTCTCGTGATCCAGGTCTTCTTAACGCAATGGTGGAGTATTATTTGAAGACACACTCCCTTGCATGCCTGCAGATATTGAGTAGCATACATGAAGCGCGCGCTCAGGCATTGTTTGAAAAGATGAATGAATGCCTGAGACACTTACCCACTCGTTTGGACACATTAACACTACTGGGACATGTTGTGCGAAAACAGCCTTCCTGGTTGTACAAGATCATAAAGACTTCATTGTTTGAAAGTCTACTGAAGTGCATGAAGGGTGACACAGATGTAGTGGTTTTAACAAGCGGCATTTTGACCATCACTACTCTGTTACCACTGGCTCCTGCCTCCATTGGTCATTGTTTACAAGACTTGTTTGATATCTTCTCCAGACTCTCCTCCTTCAGAGCTCGTCGGCAAGGCAATGCACCTGAAGTGTACCTTGTTCACCTCCATGTCGCAGTGTACATGTTTTTTCATCGACTGTATGCCATGTACCCTAACAACTTCTTGGCGTATCTAAAAGCACTGCACAGTGAACCTTCTAAACAGAGTCTCTTTCAGAATACTATCAAGCCCATGATGGAACATGTGCGGTTTCACCCTTGTGTTGTAACAGAGACAGTACAGAGTGAAACAGAAAAACACAGATGGAGACAGAAAGAACCACATGACATTGTAATAGAGTGCATGAAACTATCACTGGACCCAATTGACAGAATACAAGAGAAAGGAAGTTTTATGTCGTCTTGGACATCCAAGCAGAATTGTCAGGAACTTTTTGCTGATAAATCCATTAGTTCCATCCTTACGACATCGTGTGATAGTCAGGGCCCTGAGACGAACAGATTAAAAGAACGGCGTATGTCTGATTCGGCAACACAGACCGGCAAATCTCTCCAAAGTGGGGATAGTGGCACAGATTCATGCAGTTTGCCGGTAATTTCTTCTGACGAGATCACTGCAGGCTGGAGTCCTTCAGATGTATGTAGACTCAGCACCCCGCCATCGTCCCAGATGTCTCCTTCAACAAGCAACCCGGATCTATTATCCTCATTTAACATTCAATCTCACTGCAGTACCCCTGGGGTAATGTACACCCCTGGGCAGTCCCCTACTACATCACTTGGGGGTGACATAGCCTATCATGGATACTCTAGCTCACCTTCGGTTTCTGGGAGTAGAGGGAAGAGTGGTATGTCAGGATGGACGCATAGTGGCAGGGGTACTCCAGTTAGGGGAGGGAAGGCTGCCAGTCACGAGGGGCAGTTGACAAGAGCTTTGTATTCAGTGCTAGCTCAGCACAGTTCTGAATCAGCTCCTGCAGCAATTGGGGGACATCAAACATCCACACCAAAAGAACCAATAAAATGCGAGAAAGACCAAAAAGAAGGAACTACACATGATGGACATAATTCTTTGACTTTCCCATCTAGTAGTGCATTGAGTACGTTTCAAGTGCAAGAGGAAGAAATGAAGGAGAATTTTACAAGAACTAGTGAAGTACAATTTGATAGCGGTAATTTTAATATTTCACCCAAAGAAGAATATAGAGACTTCAGTAGGGAAGAGGATTTTGCTTTAGAAATTAGTGAATGCAAGTCCGTTGATTCACACGAGGATGTAATTAGTTCAGATTTTTTGTCAGATTCTTTGACCCCTGTAGGTGGTCAATCGTTAGATGCAATAACGTTATCCAACACGCCTAGTGATTCTATGAATATATCTGTTGACGATGGTACGTCCACTGAAGCTGAGGAAACAGGCATGTCTCAACCTTCCTATGATTCTGATAGTTCATTACCGAGTAAAGAACTTCATGAACAACCAGCCAGTACTGAGTTAGACAAAGAGCACAAGTTACTTGAGGTAAACAAAAGTGGAACTAGTTTGGCGTCCGATGAGACTTCATCGGACTTATCCAAATTTCACAGTGGAACTCCTGCCGTGCAGCAGAACCACCATCCTTTGCACACTTGTGACTTGATTGCGGCCTTTCCTCAACTGCTGCCGTTATTTAGAAGTGAGCAGGAACACAGTGGAAACAGTTCCATGGCCGATGGAGAAGACACTGCATCATCAAGACTTCAGCAGCAGTTGTGTGGAGCAAGCCCAGTGGAAATTCTTGATAATTACCTCAAGACAGGAAATAGTGTACACTATGGTGAGCTTTCAAGGATTCCTCTTGTGAGTCAAGTTGGTACAGTCTGGACACATTTTGGAGGTGAGCCTCCAGTAGATGAAGTGGAGATTCTGAGAGGACAAGTCAAGTTGCTTCATAACCAGCTGCTGTTTGAACGGCACAAGTGTGATCTGCATGCTATCCGTAACAGAAGACTTATAGGCAAGACATTCAAGGCTGCTCAGTACCAGGAAGAACTTCAGGCCACGAAAGATCAGCTGAGACTACAAGAAGATAAAATGAGGGAACTGACTGATGCACTTAACAAGCAAGTAGAAGAAAACAGGAAATTTAAAGAAATCACCTCCATTTGGGATCACCAGCAAAGGATGCAACTCAGGAATTTGTTGAATGAAAATGCTCAGTTGAAATACAATCAAAAAGAACTCCTTGAGAAGCTTGAAGCTCAGCACAAGGATTTTGATACAAAACAGACAGAGGTTCACCAGTTGAGAGCAAGAATATTCACGTTAGAAAATGAGTTGGATCGGCTTAAAGGGGAAGTGTCAGAAAAGGACCAGTTATCAGAGCAGGTGAACCACCTCGTCAAGGAACTCTTAATCATGGGTGAATTAAACCAACAACAAAAAGACACAATTCAGAAACTGACTCTGGCCGAGGGACAGAATCCTGAGAGTAACATGCAGTTACATGGCTGTCACAGAGAACTGGGAGTTGCAAAGCAAACAGTGAAAAAGCAGAAAGCCGAACTAGAGGCCGCAATGTCCAGACTCGCAGATATGGAAACCCTTGTTTCTAGCAAGGATATTGAGATTAGAGATTTGAAGAAATTCACTGAAGGACTTAAAGGAACTTATGTAGGGAAGATGCAGAGCCTTGAAGAAAAATATAATGCCCAAAAGAAGATAACACAAGCCTTGGAATCCTATATTCTTGACTTGGAGTCGTCTGTAGAGCATAAAAAGGATAAAATGGAGCATATCTCTTAA

Transcript

OS493_016981-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q92574	Hamartin OS=Homo sapiens OX=9606 GN=TSC1 PE=1 SV=2
Q9Z136	Hamartin OS=Rattus norvegicus OX=10116 GN=Tsc1 PE=1 SV=1
Q9EP53	Hamartin OS=Mus musculus OX=10090 GN=Tsc1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004722 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04388 all species →	Hamartin	Hamartin protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007483 all species →	Family	Hamartin	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15154 all species →	HAMARTIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008285 all species →	Biological Process	negative regulation of cell population proliferation	Interproscan
GO:0032007 all species →	Biological Process	negative regulation of TOR signaling	Interproscan
GO:0033596 all species →	Cellular Component	TSC1-TSC2 complex	Interproscan
GO:0051726 all species →	Biological Process	regulation of cell cycle	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K07206	TSC1; tuberous sclerosis 1	-	Human papillomavirus infection	ko05165	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016981-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

83.4Max TPM

25.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.80	32.52
polyp at pH7 6	18	18	23.47	31.40
coral polyp · control treatment	16	16	34.72	83.40
coral polyp · oil and dispersant treatment	16	16	37.14	77.01
coral polyp · oil treatment	16	16	29.36	65.57
coral polyp · dispersant treatment	16	16	19.49	33.87
Polyp	10	10	13.40	25.49

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.52
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.95
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.00
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.34
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.11
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.01
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.18
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.87
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.85
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.04
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.33
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.29
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.01
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.87
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.02
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.81
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.19
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.96
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.40
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.89
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.56
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.23
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.37
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.41
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.87
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.46
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.78
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.74
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.56
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.43
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.20
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.52
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.56
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.53
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	83.40
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.93
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.89
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.05
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.55
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.40
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.76
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.04
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.42
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.05
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.52
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.24
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.35
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.53
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.36
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.12
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	77.01
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.88
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.51
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.30
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.00
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.35
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.28
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.16
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.50
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.29
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.26
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.22
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.03
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.42
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.12
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.57
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.23
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.02
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.25
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.75
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.04
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.32
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.63
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.60
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.85
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.23
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.20
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.84
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.63
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.23
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.87
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.18
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.55
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.11
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.14
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.67
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.52
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.62
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.63
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.56
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.72
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.68
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.31
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.57
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.28
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	25.49
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	20.94
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	17.77
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.29
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.93
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.42
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.59
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.98
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.86
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.78

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.