Gene detail

Detailed information of OS493_016985-T1 in Lophelia pertusa

Genomic Location: scaffold_53:1780935...1790461
NR annotation: KAJ7360353.1, hypothetical protein OS493_016985 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_016985-T1

ATGAAAGGAGGAACACCCAAGCTCCCTTCTAATGCGGACGTCAAATTCCCAAACTTTGAAGAAATCTTTGTCAAAACTGGATTAGGAGAAATTAGCTCTTCGTCACAGCAAGTGATGAGCGTGGATGGAAAATTAGTTCCCTTCTCGTGTAACTCTACCATAACTTACTCACCTGAGGACAAGCAACAGAGTAAGGTGCTGTCAGAGACGGTACAAGTGTCTGCTGTGGATATCAGCTATCCACATCAAACTGATACGCTTAAAATTGATATGACTGCATCTATTCAAAGAGCGTCGTTGTCCGACCGGTGCCCTGACGGTTTGGTAGAGCAACCTTCAAGTCAGTATTGTCAAGATATCAACGAATGTGCTGCTGTTCCTCGAGTTTGTTCTCATTTTTGCGAGAACTTGTTTGGATCATTCCGTTGTTCCTGTCCTGTGGGTCACAATCTCACTTCAGACAACAAGACTTGTGAAGATTTAGACGAGTGCAGCCTGGGCATTGATTCGTGTCCTTCAGGTCAGGAATGTGTCAACACTCCTGGGGGATACCGCTGCCGTGTTAAATGCGCTGATGGATTTGTCATGACTGTTAATGACACCTGTGTTGATGTGAATGAATGCGAGTTTGCGTTGTCAACGGACTCGTTACATAGGAATGATCCATGCTTACACCAATGCGAGAATCTGCCAGGTTCATACAGATGCTATTGTAAGGATGGGTATCAACTAACGGGAAACCGATGTGAAGACATTGATGAATGTGCCACCAGTAGTGTGTGTGATCATGGCTGTGAGAACAGAGAGGGAAGTTACAGGTGCTTCTGTTATCAAGGATATCGGTTCAAATCTGACAGCGAATGTCTGGATGTGGACGAGTGTGCTGAGAACAGCACTCTCTGTGGCAGTCTTCATTGCGTTAACTTACCAGGCAGCTTCCAGTGTTTAGGACAGTGTGATGTGGGCTTCAAAAGAACCATGGATGATAAGGAATGTGTAGATATCAATGAGTGTAATGAAGGTCAGCACAGCTGCAAGTTGAACCAGATGTGTATGAATACATACGGGAGCTTCTACTGTGTCTGCCCCAGGGGCTACTCGGCCAAGACGCCCCAGTCCCCTTGTAAAGACGTGGATGAGTGTGAGCAGTTTCAAGGCATCTGCGAGTTTCAGTGTGTCAATTCTATTGGCAGTTTTGAGTGTTTATGTCCAGGCGGAGGTGTTCTCAATGCAGATCAACGCACGTGTACAGGTGTGGACGGCTGCGCCCTCGATAACTTGAAATGTGAACAGCGGTGTGACTTTTCGGCGCAGGGGTACAAATGTTCGTGTTCTCGTGGTTACCGACTAGCTGACAATAAGCAGGATTGTGTGGATGTGGATGAGTGTTCATCTAATACCACCAACTCGTGTCAGTTCGCCTGTATAAACACACTCGGTGGTTACAAGTGCGAGTGTCCAGTAGGATATCACCTCAGTGCTGACGGCAAAAAATGTCAAGACGTGGATGAGTGTGCTCTGACTGGTGGACCGTGCAGTCAGAATCAGTGTTATAACACGAGAGGTAGTTATCAATGCCTTCCATCCTCCTGCCCTCAGCAGTATCAGAACACCGGAGGCGGGTTCTGCGTAAACCAATGTTCAACCCCAGGCTACTGCGCAGCTCAAGCAACCCGCCAAGAAGTGTTCACGTTACCGCTTGGATTTCCCGCCAATACCGACATTGCCCGCTTGATTCCATTTTTCCCGCCATACATGGCCTCGCTTCAGTACTACTGCCAGTTTCAGTACGCGTTCTCGGTCCAGCCCTCTCCGTTCGGCATCAGGATGCTTGCGAACGAGGCCATGATCTACACGAAAGAAAAGCTGGAAAAGGCGGGAGTTCATCAGCTGCGGGTCACCGCGGATTTGTTTTATACGGATGGAACGCTGGCCTGTAGGACTGTGTTTACAGTGTATATAGACATCGCTAGGTTTAGTTTTTGA

Transcript

OS493_016985-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O77469	Fibulin-1 OS=Caenorhabditis elegans OX=6239 GN=fbl-1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004396 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07474 all species →	G2F	G2F domain	Domain	Interproscan
PF14670 all species →	FXa_inhibition	Coagulation Factor Xa inhibitory site	Domain	Interproscan
PF12662 all species →	cEGF	Complement Clr-like EGF-like	Domain	Interproscan
PF07645 all species →	EGF_CA	Calcium-binding EGF domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000152 all species →	PTM	EGF-type aspartate/asparagine hydroxylation site	Interproscan
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR018097 all species →	Conserved_site	EGF-like calcium-binding, conserved site	Interproscan
IPR052080 all species →	Family	von Willebrand factor C/EGF & Fibrillin	Interproscan
IPR001881 all species →	Domain	EGF-like calcium-binding domain	Interproscan
IPR006605 all species →	Domain	G2 nidogen/fibulin G2F	Interproscan
IPR009030 all species →	Homologous_superfamily	Growth factor receptor cysteine-rich domain superfamily	Interproscan
IPR009017 all species →	Homologous_superfamily	Green fluorescent protein	Interproscan
IPR026823 all species →	Domain	Complement Clr-like EGF domain	Interproscan
IPR049883 all species →	Domain	NOTCH1 EGF-like calcium-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47333 all species →	VON WILLEBRAND FACTOR C AND EGF DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17307	FBLN1_2; fibulin 1/2	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_016985-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

27.1Max TPM

10.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.58	27.07
polyp at pH7 6	18	18	14.03	24.43
coral polyp · control treatment	16	16	11.70	20.02
coral polyp · oil and dispersant treatment	16	16	9.23	19.39
coral polyp · oil treatment	16	16	11.04	16.39
coral polyp · dispersant treatment	16	16	8.21	18.78
Polyp	10	10	4.42	12.31

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.07
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.59
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.08
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.66
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.79
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.76
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.71
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.13
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.69
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.95
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.64
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.17
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.59
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.04
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.79
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.43
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.40
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.74
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.95
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.89
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.70
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.08
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.33
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.93
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.89
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.58
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.22
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.15
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.28
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.29
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.66
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.02
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.72
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.03
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.91
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.14
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.52
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.14
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.49
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.09
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.48
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.09
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.52
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.07
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.65
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.29
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.04
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.39
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.07
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.38
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.25
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.22
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.23
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.45
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.85
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.49
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.69
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.78
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.52
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.06
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.53
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.39
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.03
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.94
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.51
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.46
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.66
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.25
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.49
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.62
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.41
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.33
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.22
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.37
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.42
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.87
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.65
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.78
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.79
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.82
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.97
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.33
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.38
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.14
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.20
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.05
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.99
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.40
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.39
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.49
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.98
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.19
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.31
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.53
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.46
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.03
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.43
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.34
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.08
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.60
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.39

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.