Gene detail

Detailed information of OS493_017042-T1 in Lophelia pertusa

Genomic Location: scaffold_54:14277...36830
NR annotation: KAJ7333505.1, hypothetical protein OS493_017042 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017042-T1

ATGGAAGGAGTGAAGAAAGTTTATAACGACATTCCAAAGTCACCTCGTGACGATCGGCTGTATCGAGGCTTAGAACTGAACAACAACATGAAAGTTCTTGTGATCAGTGATCCCTTGACAGACAAATCTGCCGCGGCCTTGGATGTACATATTGGTAGCATGAGTGATCCAGATGATCTTCCAGGTCTTGCTCATTTCTGTGAGCACATGCTGTTTTTAGGAACAGAAAAGTATCCATCAGAGAATTCATTCACTCAGTTTTTAAGTGAGAATGGTGGATCTTCTAATGCTTTCACTGGTGCAGAACACACTAATTTTTACTTTGATGTCAAACATGAGAGTTTACATGAAGCTTTAGATCGGTTTGCACAGTTCTTCCTCTGCCCATTGTTTAATTCAGATGCAACAGACAGAGAGGTCAATGCTGTTGAGTCAGAACATCATAAGAATGTCCTGAGTGATTCTTGGAGAATGAATCAGCTTGACAAGTCCTCAGTTAATCCATCTCATCCTTATAGTAAATTTGGCTCAGGAAACAAGCTTACTCTCGAAGCCAGACCAAAGGAGAAAGGACTTAGTGTACGTGATGAATTACTCAAATTTCACAGCTCATCTTACTCGGCCAATATCATGGCAGTGGCTGTTCTAGGGAGAGAATCGCTTGATGATCTGACAAACCTGGTTATAAAGCTCTTTTCTGAAGCCGAGGATAAAAATGTTCCAATTCCTGAGTTTCCTGATCACCCTTATGGCGAGGAACAGCTACAGGTAGAATTTAAAGTGGTACCAATCAAAGATATAAAACACTTAAACATTTCATTCCCCATCCCTGATGTTAGTCAACACTATGATAGCAAGCCATGTCATTATATATCTCACCTTCTTGGTCATGAAGGTAAAGGAAGTTTACTGTCAGATCTCAAAACAAGAGGGTGGGTCAATGAGCTTGTTGCAGGAGCAGCTGCTGGAGCTAAAGGCTTTATGTTCTTCATCTGCAACATGGAACTTACCACTGAGGGCCAAGACCATGTCTATGAAATAGTGACCTGTGTATTTCAATACCTGGAAATGCTAAGAAGGCAAGAACCCCAGGAGTGGATCTTTAAAGAGTGTCAGGCTCTTGGTGAAGTCAGGTTGCAATTTAAGGACAAGGAGAATCCAAGATCCTATGTCTGTTCAACTGCTCGCTGTTTACATGACTTTGGTGTAGAAGATGTCATTCAGGGCCAATTTATAATCAGGCATTTTAAACCTGAATTGATTAAGACGATTATTTCATATCTTGTTCCATCAAAAGTGAGAATAACTTTGGTTGCAAAACTTTTTGAAGGCCAAACTGATCTTGTAGAAGAGTGGTATGGAACAGAATATTCTGTAAACAAAATCTCTCAAACGTTCATAGAGAAATGGAAGAATGTGTTATTGAATCCCTCTCTGCAACTTCCTGAGGAAAACGAGTTCATTCCTACAGATTTTACAATCAGGGAAAGGCCCCAAGATTCTTCATCGATTCCCTCTCTTATTAAGGATGACTCGCTGTTGAAAGTTTGGTTTAAACAAGATGACACATTCCACCTACCCAAGGCTTGTCTTCTGTTTGAAATTACAAGTCCATTGGCATACGTGGACCCTTGTCACTGTAATATGGCACACTTGTTTATAGAGCTGCTCAAGGATTCATTAAATGAGTACGCTTATGCAGCCGAGATAGCTGGAGTGAACTACAAACTGGAGAACACCATGTATGGAATCTTTATGAGCATCAAAGGGTATAACCACAAACAACCAGTTTTACTGAAGAAGATTTTTGACAGAATGGCAAACTTTCAAGTTGATCCAAAAAGATTTCCGCTCATCAAAGAAAGGTTTGGAGTTGCGCTGAAGAACTTTGTTGCTGAGCAACCACATCAGCATGCCTTGTACTACACGTCATTTTTATTAGAAGAACTTGCCTGGCACAAGGACGAACTTTTAGAAGCACTAGAAGAGGTAACCCTGGAGAAACTTGTGGCTTTCATTCCTTATTTGTTGGGAAGACTTCATATCGAGTGTTTGTTTCATGGAAACTTGACCAAAGAGGAAGCGATTGGCACCGCGGATCTCGTGGAAAAGATTATTAAAGAAGACAGCAAAACCAAGCCTTTGTTACCACTGCAGTTAATTCGACACAGAGAGATACAGTTACCAGGCGGTTGTTCGTATTTATTTGAAGTGCAAAATGAAGTTCATAATAATTCAAGCTTGGAGATTTATTATCAGTGTGACTTACAAGCCACCAAAAGTAATGTTCTTCTGGAGTTGTTTTGTCAAATCATCAGTGAGCCGTGTTTTAACATCCTTAGAACTCAGGAGCAGTTAGGATACATTGTCTTTAGTGGAGTAAGAAGATGCAATGGTGCCCAGGGTCTTCGGGTCTTAATCCAGTCCGAAAAGGAACCTTCTTTGCTAGATTCGCGTGTTGAAAATTTCCTTCAAGGAATTGAGGAGTACATCAAAACGATGTCGGATGAAGAATATAAGAACCACATCGAGGCAATGGCGGTCAAAAGGCTGGACAAACCCAAGAAACTATCCTCAGAATGTTTGAAACATTGGAAAGAAATTCTCTCGCGACAGTACAACTTTGACAGGGATAATATCGAGGTGGCATTTCTAATGGCGGTCACGAAGGAAGATGTTCTGACATTTTACCGGGATCTTCTCGCAGTTACTGCTCCCAGACGGCACAAGTTGGCTGTTCATATTTTGTCGAAAACCATGACCAAGATTGTGAATAACAAAGCCGTGAACGGTGACATCGAAAATGAGAAAAGTGAAGATTCTCCACCCTCGCCAACGATTATCGATGACATTGCAGCATTCAAGAGTGGCCTTCCACTATTTCCTCTTGTACCACCATACCACAGTCAACCCACGAAATCCAAGCTCTAG

Transcript

OS493_017042-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P14735	Insulin-degrading enzyme OS=Homo sapiens OX=9606 GN=IDE PE=1 SV=4
Q24K02	Insulin-degrading enzyme OS=Bos taurus OX=9913 GN=IDE PE=2 SV=1
P35559	Insulin-degrading enzyme OS=Rattus norvegicus OX=10116 GN=Ide PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001201 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05193 all species →	Peptidase_M16_C	Peptidase M16 inactive domain	Domain	Interproscan
PF16187 all species →	Peptidase_M16_M	Middle or third domain of peptidase_M16	Family	Interproscan
PF00675 all species →	Peptidase_M16	Insulinase (Peptidase family M16)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007863 all species →	Domain	Peptidase M16, C-terminal	Interproscan
IPR050626 all species →	Family	Peptidase M16	Interproscan
IPR001431 all species →	Binding_site	Peptidase M16, zinc-binding site	Interproscan
IPR032632 all species →	Domain	Peptidase M16, middle/third domain	Interproscan
IPR011249 all species →	Homologous_superfamily	Metalloenzyme, LuxS/M16 peptidase-like	Interproscan
IPR011765 all species →	Domain	Peptidase M16, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43690 all species →	NARDILYSIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0043171 all species →	Biological Process	peptide catabolic process	Interproscan
GO:0051603 all species →	Biological Process	proteolysis involved in protein catabolic process	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01408	IDE, ide; insulysin	EC:3.4.24.56	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017042-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

48.3Max TPM

22.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	18.26	33.36
polyp at pH7 6	18	18	21.39	44.84
coral polyp · control treatment	16	16	27.20	43.73
coral polyp · oil and dispersant treatment	16	16	33.40	48.26
coral polyp · oil treatment	16	16	22.46	35.60
coral polyp · dispersant treatment	16	16	19.93	33.46
Polyp	10	10	10.88	28.21

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.36
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.08
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.16
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.64
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.38
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.46
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.08
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.57
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.45
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.00
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.51
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.34
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.26
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.11
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.07
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.70
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.52
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.03
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.84
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.52
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.39
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.44
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.87
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.45
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.65
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.91
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.64
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.63
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.58
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.32
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.30
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.01
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.67
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.87
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.92
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.95
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.73
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.03
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.60
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.28
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.26
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.77
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.53
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.54
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.93
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.58
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.75
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.87
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.14
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.51
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.25
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.26
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.74
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.10
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.60
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.85
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.20
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.86
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.72
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.27
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.38
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.69
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.18
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.77
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.84
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.58
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.60
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.96
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.81
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.55
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.03
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.68
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.04
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.20
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.59
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.36
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.91
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.91
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.46
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.82
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.15
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.69
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.53
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.24
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.04
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.84
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.10
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.78
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.58
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.32
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.25
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.26
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.31
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.50
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	28.21
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.17
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.45
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.75
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.72
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.03
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.53
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.66

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.