Gene detail

Detailed information of OS493_017050-T1 in Lophelia pertusa

Genomic Location: scaffold_54:124489...139465
NR annotation: KAJ7333513.1, KAT8 regulatory NSL complex subunit 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017050-T1

ATGTCGTCGTTTTCGCTTTACAACGAAAGGGGAATCATTCGAGATATCCAATCGCTTACCGAGATTATTCTCATCGATCACTCATATGCCAAACCATGGTCTGCACATCCAGATGCATCCAAAGTGCGCCCAGTTAAAACGCTGTTTCTGCCCAGAGAAGACGTAGAAAACGTGCCTTTGATCGATGATGAAGAAATCGATGTTTGCGATCCGGTCGCCCCTTCATGTTCTGCCAATATTATGTATGACACTACCAAGGCTAAAGGAGTGATGGCTGAATGTGAGAAGTATGTGAGTACTGTGTCTAGTAAAAAGACTCCAGATACGTGGGAAGAACAAATTTCCAGGAATGGCTGGGGAACTAAGCAGAGTATTTTGTTTGACAAAATTACCAAAGTTCTCTCAAACCTGAGATTAGCAAGATTGACTTATGAAGGGCTTCCAAATGAACCAGTGATGAGACGCATAACAACAGACAAGGCAACCAAAAGAACTAGACAAATTCTTAGTGAAACAGAATGGGACCCAAATTTAATGAAATGGCTTCACAGCACTCTAGTGGATGGTTTGAGTATTCCTCTGTTGGCGTGCTATCTTGACGTACTGCAGACCTTGCGAGCCAAAGTTCCGACTCTTGTTGATCGGATGCTTGTACAGCCTACTAGTCAGCGTCGTGGGCTGGCAACCAGCTCAGAAGCCCTGAGCTTGCTTCTCAAAAGACCTTGGGACCCTGCTCATGGACTAGTGACACAACATAAACAGCGTAAACTTCCTGGAACTCCTTTGTTATTGGTTGTGCCAAGTGGTCCTACGACAAGTATTAGTTCTGGAACATCATCCAAGCGTGCTCGCTTCTGGCACAACCATCTGTCTACCCTTGGTAAAGTTGTCCCTGTGACCATGCACACCAGTAATGGAGGAAGTGGCGTGTCAATCAGTCAGTGTTTGGACCACATTATTGGTGCTGTTAGGATCAAAGTACTGGAGTTAAGAAGTCATTTCCCCAATCGTCCCATTATTCTGCTTGGCTGGTCTGTGGGTGCTTTAGTTTCTTGTCAGGTTGCGTTGATGGAATCTGTGTGTGCTGTTGTTTGTCTTGGTTTCCCAATCACTGGTCTTAGTGGTGTAAGAGTGGGAGTAGAAGATCCTCTTCTGGAGCTGAAGACACCCACATTGTTTATTATTGGTTCACATTCAACTCTCACATCACAAGAAGATGTTGAGGAGATGCGTGAGAAAATGAAAACAGACACAAGTCTGTTAGTGGTAGGAGGAGCAGATGAACAGTTACGTTTGACTCGCGCTAAAAAGAAACAAGAAGGCCTCACACAGAGCATGGTGGATCGATTGATCATGGATGAAATCGGTGACTTCTTAGGAATTGTTTTGACGTGTATGAACACCAGCAGTGTACACAACAGAAATGACTCCTCTGACGTAGACGAAGTCGACACTCGCAAAAAGAAAAGGAAACGATCGGTGTCACGTGATTTGAGCTCTGAAATGGATCGCTCGGTGGGAAAGCAAGGGGTGACATCACAGGCATCGGCCAAGAGATCCACACCTCAAAAGCCTTCCGTTCAAGATCAGGGGAAAACGCTGCTCAAGCTACCCCTTGGCAACACCATGGGGGCTATAAGCAGCGTGCGCTCACTAAGCCAGCCTAGTCCTGCTAAGCGGCCACGGACGTCCAAGTCCAAATCAAAAACAGCTAACCCGCCTCCAAGTATAATTCACGTGACTGGTGCTGCGCCTACAGCCGTAGTCGGCAGTGTTCCTCAAACAATCTCCATGCACCCAGGTGCTATGCAAGGATTTCCACTGCATGGTGCCACTGTTACTCGACAGGTTCCCATGTCAAGTGCTTCTGCGGCCGCACTGGCGTCTGCCGGCAGAGGACAAGCCTTCATTTCTCTGACTCCCAAGAGCTCAGACCCTGGAGTAAGAGTCACACAGACGTTTATCACCATACCGCGCGGAAGTTCTCCGTCGGTCATGTCTTCAAACGCTGCAACTGGACAGACAGTGCAGTATATTATTAAACCTCAGAGCCAGCGCCACACACCTGTGAACCTCAATGCGGTAAGTGCTGCTCTGTCTGCTCAAGGTGGTGTTGTATCTTCCGGTGCTCAGCTGCCTGTAAGGAGCATTGTATCAGCTCCAGTCAGGCAAACGCCTCTCTCCCAATCACCCGCTTCGTCCTTTACTTCTGTAATGAGTCTCAAAGGTGCCGCTGTAACAACACAAGCTCCCTCTTTTCCACCCGGTGCTGTACCAGCGTCTAATGTTGCTTTAGCTGCAGCTTCATCCCTTGGGAAGTTTTCCCCATCATCAGCTGTCCTGACCTCCGGCAGACCTACTTTCACCCGAGTGGGGGACATGCCTCAACCATCAACCATCAACGTTCTGACTAAGGAAGGTAACAAGCTGGTAGTGTCCCAAGCGATATCGTCTTCTGGTCTCAAAGGGTCGTACAAGTTAGTCAGTGGCGCAACGCTGCAAACTGTAGCCACTGGAGCGACCGGTCAATCCCAAGTCGTTTTTGGCCATCCTGTGCGGTCGGCTTCCGGTGGTGCCCAGACAGTGGTTACTCATAAAGGGTCTGGTGTGCCATGTACTGTTACTACCTCGTTGCCTGTAAGCCTTGCTGCGTTAGCTGGGAAACTACCAAGTAACACCACAATATCACAAGCCGGTGGTCGAGTGACCCTTGTTCAGAGCACTCGGGCAACTACCCTCCCCAGTCAGACAGTTAGGACCATCCCCGGCCAAATGGTCTCTGTACAGAGATCAGTAGCGAACAGGACTACCAACCCGCACACTGGCGTGGTAACAACTTTTCCAGGTACAGTGACAGTCTCTAGAGCCGGAACAACTCAGATTACCAGGGTCGTCTCGTCTGGATCACCCGTTACTAATATTCAGACTGGAACAGCCTTTGTGGCTGGTAAAACTATTGATTACCCTGTGGTCTGTTCACAGGTAACTCCCAAGACGGCCCCCACCTTTGTTGTTTCCTCCATTCCCGGGACCAAAGTGGTGCCATCAACGCAAGTGCCATCAATTGGCACCAAGACCACGACAGTGTTGCCTGCCGCTGCTGTGAAACGGACGGAGTCACAGACTGTTTATACACCTGTTCCTATGACAAGCTTGAGTGGTATCCCTGGTCAACAGATCCAACAGATCGGAAAATCGCTACTCACGGCTCAGGTCGCGGCTGTAAGGCAAAGTACTGCAGTCGGACATTCGGAAGTGAAGGAACGGACACCAGTGGCGCCTGACGATCCCTCCGCTAAGGAGAAGACTTCAACTTGA

Transcript

OS493_017050-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3KR73	KAT8 regulatory NSL complex subunit 3 OS=Rattus norvegicus OX=10116 GN=Kansl3 PE=2 SV=1
A2RSY1	KAT8 regulatory NSL complex subunit 3 OS=Mus musculus OX=10090 GN=Kansl3 PE=1 SV=1
Q9P2N6	KAT8 regulatory NSL complex subunit 3 OS=Homo sapiens OX=9606 GN=KANSL3 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005546 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20408 all species →	Abhydrolase_11	Alpha/beta hydrolase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR046879 all species →	Domain	KANL3/Tex30, alpha/beta hydrolase-like domain	Interproscan
IPR026555 all species →	Family	KAT8 regulatory NSL complex subunit 3/Testis-expressed sequence 30 protein	Interproscan
IPR029058 all species →	Homologous_superfamily	Alpha/Beta hydrolase fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13136 all species →	TESTIS DEVELOPMENT PROTEIN PRTD	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0043981 all species →	Biological Process	obsolete histone H4-K5 acetylation	Interproscan
GO:0043982 all species →	Biological Process	obsolete histone H4-K8 acetylation	Interproscan
GO:0043984 all species →	Biological Process	obsolete histone H4-K16 acetylation	Interproscan
GO:0044545 all species →	Cellular Component	NSL complex	Interproscan
GO:0045944 all species →	Biological Process	positive regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16719	KANSL3, RCD1; regulatory NSL complex subunit 3	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017050-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

34.2Max TPM

19.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.54	24.63
polyp at pH7 6	18	18	18.50	28.39
coral polyp · control treatment	16	16	19.70	31.43
coral polyp · oil and dispersant treatment	16	16	24.04	32.69
coral polyp · oil treatment	16	16	18.85	27.82
coral polyp · dispersant treatment	16	16	19.68	27.75
Polyp	10	10	19.09	34.17

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.63
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.28
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.96
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.68
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.47
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.12
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.40
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.04
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.73
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.73
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.51
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.78
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.69
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.08
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.75
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.60
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.71
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.39
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.02
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.24
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.44
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.76
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.73
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.71
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.20
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.10
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.13
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.45
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.33
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.28
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.49
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.15
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.43
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.57
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.88
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.22
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.96
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.83
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.79
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.11
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.41
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.19
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.90
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.71
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.24
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.95
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.43
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.69
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.86
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.03
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.23
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.71
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.87
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.78
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.25
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.76
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.71
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.82
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.86
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.40
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.12
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.82
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.76
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.55
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.14
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.04
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.52
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.50
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.03
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.56
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.13
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.51
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.07
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.77
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.46
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.79
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.75
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.46
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.34
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.83
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.08
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.25
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.44
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.73
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.45
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.41
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.91
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.76
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.26
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.19
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.56
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	34.17
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	23.15
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	23.01
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	22.33
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	16.79
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	15.55
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	15.49
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.27
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.87
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.33

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.