Gene detail

Detailed information of OS493_017092-T1 in Lophelia pertusa

Genomic Location: scaffold_54:549239...584510
NR annotation: KAJ7333554.1, A disintegrin and metalloproteinase with thrombospondin motif 14 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017092-T1

ATGACGAACCTCTTCGTGGTATGGTTATTGCTTTGTTTGTGCGCATGGACCGAAGCAAGATACTCTTGGAAGGATAAAATGAAGCATCGGAGCGCAGAAGAGAAAACAAGTTGTAAAGGACTTGCAGCTAGGAACACAACAAACGAGGAGATCTTATTCGGAAGCAGATCCTCTTCTATGTACATCATCTGGCTAGCGGCAGTCAGGCAAACGTGCACCACCCTGTGTCGCAGTTATATTAAGTTATGTAACAACAGTTTAACAACTAACAGTGAACACTTGATCAACTCATTAGGAGAGTTTGATATCACTTACCCGGCTGAGTTAAATCATCGTGGTCAGGTGACCAACCACGTGACTACCCTTTCCAGTCATCGACGTCGTCGGCGGAGCGTAAGCGAGGAGGCTGGTCCCATAATCTATCAGGTCAAATTTAAGGGAAAAATCATTAAAATGGTTCTACGAGTAAACACGAAGCTGTTCGGATCAGACTTTACTATCGAGCGTCACAAAGAGGATGGAACCATTGAGAGAAAAACGAGCACAGATGTTCATTGTTATCTTGTGGGCGAAACAGAATCATTCCACACCAGCGTGGCCATAAGTGACTGCGATGGACTGGCAGGAGTCATAAATTTAGGAAATGACACAATTTACATCGAGCCCGTGTTAAACACAAGCCTTATGATCCATCGGGGCTGGACCAGGCCTGGCAGACCGCATCTGATGTATAGTAAAGGCGTCCTAAAACAGCCGAAAGAACATTACACTGACTTGGTGTCTGACGGGCTAAAAATGGAGAACTACTCTACAGCACTAAAAGTGGACGGTGAACTGAGTCACGATGCAGCAGCTCGTACGGAAGTTTCTTACATTAAAATCTTGAACCAAGCAGTCAGGGCGATAAAGATTTACTATATCATGGACGGGAAAGAATCAATGTTCCAAATGTTGAGAGACAGAGAATCGGTGAACGTAGATACTTATACAACTCACAGCTGGGTAGCAAGAGACTTCGATACCGGCAAACAACTCTTTATCAACGGGAAAAAGATCTATATCCCACCAAGTGGCACTTCTCTCAGAAGACGAATCAAGGCTTACGTCACAATACCACCTGGACTCAAGCTTCCTGCAGCTACCAAGCCCTTTGAGCCCAACAGTCACATAACATTTATCAACAAATCACATCGCTTTGTGAGGCTATATTACATCGAGAACGGCGAAATAGTCTTCTTTTACAATCTTTCCCCGGGAGAGGAAATGGCGGTGAACACGTTCACTTCCCACAGATGGTTTGTCAGGGACCTCGACACAAACAAACTACTTCATGTAAATGGGCATAACGATTATACGCCAGCTGAATCGGATATTGATCGCCGGATACGAGTGTACATCACCGTGCCAAGTACAATTTTTCTTCCCGATATGAAATTTCCTGACATGCTCAAATCAAAGCCCAAGTACATAGAAGTGATGGCAACCGCTGACAGCTCAGTAGTGCGGTTTCATGGCAAAGAGAAATCGGAGAAATACATCTTAACTTTGATGAACATTGTCTCCAGAATATTTCAACACAAGTCAATTGGTGCTCCTGTTTACTTTGTTGTTGTAAAAACTTGTTCTTTTAGAGAAAGATCCGAAATCAAAATTACTGGCAAACCTATGCCTAGTTTAACAAGTGTGTGTTACTGGGGCCACAAGGCGCGGAAAGGCTTTGATAAAAGGACCAAGGATTTCTACGATCAGACTGTTTTCTTAACAAGAAAGGACTTCGGACCATCAGGTTACGCCCCAGTTCATGGCATGTGCTATCGAATAAGAAGCTGTACCCTAAACGAGGAAGATGGATTTACGTCATCATTTATCATCGCTCACGAGACAGGACATACATTAGGAATGGAACACGACGGAGTAAATAACAACTGCTCTAATGACGTCATCAAGGGAAGCATCATGGCGCCTCTGGTACGATCCCGGTTTGACAGGTTTTACTGGTCTTCTTGTAGTCGGCAAGATCTCTTGTCGAAACTCAAAGCCCTGTGGTGTTTAGACGACGTGCCATTCAGAAATAAAATTCCTTATTTGAAAAAACTTCCAGGTCAGATTTACACCATTGATCAACAGTGTCAGCACGACTTCGGCAAGAGTTCCGGGTTCTGTAGCGGGATGAAGCGCGATCCTTGTGTAGAGCTGTGGTGCAGAAGCGTGACTTATTCCTCGTATAATAGCCGCTACTGTCAGACACGCCGGAATGCTGCCCTGGAAGGAACCAAATGCGGAGTAAATAAGTGGTGTCGTCTCGGAAAATGCGTTTCAGTTGATGACGAAGATGTTACTATTCCTCTTCCTCGACCGACGATAACACCTGTACATGGTGCCTGGAGTGGGTGGAGTGAGCTCAGTGGATGTTCCCGGTCCTGTGGTGTAGGGATCAGATACAAAACCAGAAAATGCAACAACCCTGAACCCAAAGATTTCGGAAGTCCTTGCGAGGGGGAGCATATTAAATTTGAACTTTGTAATGCTATGGACTGCCCAGGTCAGCTGTTAACCTTTGAACAATCACGAAATGAGCAATGCAAGACGCGTGCGCGTTTGTCATCACCAGAAATCACAGGAGAGTGGTCTTCATATGATATTTTTAAAGCTAACATCGACTGTGACTTTGAGACTGACTTGTGCGGATGGACAAATGATCCACATGATAATTATGACTGGAAGTACCACAGGGGCAGGACTCCAACAGCTGGTACGGGCCCCAACACAGATCACACCAAAGGAGCAGCCGGCCACTATGTATTTTTGGAGACCTCTCGTCCCATTGGCCCAGGATGGAAAGCTCGGCTCGTCAGCAAGTACATAGGCACGCGTGTTGCGTGTCTTAAGTTCTGGTACCACGCTTATGGTGGTGACGCTCATATGGGCGAACTTCAACTGGTAGTTAAAACACATTTGGAAGAGAAGGTGGTTTGGAGTGTAAACAGAAATAGAGGCGATAGATGGGTGTTGAAATATGCCACGATATTTAGCAAGAGGCCGTACAAGATCATTTTCCAAGGTGTCAGAGGTGATGGCTATCTCAGTGATTTCGCTTTGGATGACATCTCGCTTGAGAATAACCCGTGTGGCCTGGGAATGATGAGATTAACAAACATCAACAACAAAATAGCTCTTGATCCTTGTCAACAGTTTTGTGAAGCAACTGAAGACGGAATTAATGTAGATATCGTACCACTGGAATTAGAAAACGGGACCCGTTGTCATGACAATCTTAGTTCGTTTGATGTCTGTATCCAAGGAAAATGCCAGCAAGTCGGATGCGATGGTGTCATTGGATCAAACACAACTCTGGACAGTTGTGGAGTGTGCGATGGCAAAAACGACTTATGTTCACCAACTAAAGGGTACATTACTACATTACCTAAAGAAGATCTTCAGACATTACTGGAGTGTCCAGTGGGAGCTACAAACATCGTGTTAGAAGACTCGTCCCCAAACTTCCTCGTTCTAGATGGCATGGGATCAGAGAAGCCGTATTTTAATGGCGCTGAAGAGAAGTCAGTGTCCACAGTGCTTGAATTTGCTGGTTCAAAGTTCACTTACAAGCGGCAAGGTCACAAGGAGTTTCTGAGTGCACTGGGCCCGATCAAAGACAGGATCATAGTGAAGCGACGATCCAGCCCTATAAATCTACATTATATGTTCTACAAACCAAAAAGTAATGGAAGTCAGTACTACTGGACACATTTCAAGTGGTCTGATTGTTCTAGGACGTGCGGAGAAGGAATCCAAACACACGTATACAAATGCCGCAAACAAGATGACAACGCAGAGGTCGCAGTAATTAACTGCTTTTCAAGCAACAAACCCGAGCCTTTGACAAGATCTTGTAACTTAACGGCTTGTGAGAGCTATGAATGGAGTGTCTCCAAGTGGAACAACTGTTCGTTGCCTTGTAATGGTGGAAATCAAACTCGTACAGTGCAATGCAAAGGCGTGGTGGCTGATCTCCAGGTCAACTCATCACTCTGCACCGCGGAGAAACCTGAGACCGAACAAGGCTGTAATGACGAGTCGTGTCCCGCGGAGTGGATTGTGGGTAACTGGTCAGAGTGTTCTCGAACGTGTGGGAATAGTATCCAGTCCCGCTCAGTTCAGTGCCGGGATATACTTGGCGCCTTGTCGTTAAATTGTCCACGTGACACCAAAGCAGCAACTAACAGGGTTTGTAGGAACGAGCCTTGTGACGGGGATGTTTTCACAAACATGTCTTGCTCGTTTGAAAACGGGTTTTGTAAGTGGAAAAACGTGAAAGGCTCTAAGCTGGATCAGTTTGATTGGACCCTGTTGAACGGCAGTACACCAAGCAGGAACACGGGACCTTCCAACGACCACACCCTGGGAACGTCAAAAGGTTTTTATGCTTACACAGAAGCATCAGATCCACGAAAAGGAAATGACCGTGCGAGGTTAATAAGCCCAGTGGTTCGGGCCAAAAAAGTCTGTGTTGACTTCTGGTATCACATGTACGGTGCAAACATGGGCTGGCTTCGTGTAATCTTAAGGAGTACAAGCACACGCAGAGAGCGGCGGTTATGGCATAAATCAAGAAATCAACTCAATGAGTGGCATAATGAACGACTGGCTATTTTCTCTCATGTACCATATCAGATTATAATCGAGGCTATTCGTGGAAGAGGATTTTCCAGTGACGTAGCGTTGGACGATATAAGAGTTACAAGCGGTAGATGTCCCAAGCTGCACGAAACACGTGGAAGCCTCTTGTCACGTGCTGATTTCAATCCACCGAAAAAGAGACGTCTGAGATTCGAGTACCAAATTAATGGTGACGAATTAACATGTACGACAGCTGGAGCTGTTAATAAAGCCGGGAGGAATAAAACCCCAAACTCCCCGGAGTCTCGTTCTATACGAACGTCCCATAGCAGTGATGACGAGTTACCAGGAGATTCATGTTGTGAAGGCATATATCACCTTTACCCGTCGTATAGCTCTCTGAAAAAGCAATCTGAGAAGCATGCCACAAGACGCCTATCAAAAGCTAATTACCAAGGTATGACGTTCCGCGAGCGAGTAACAACTCATCAGAGCTAA

Transcript

OS493_017092-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O95450	A disintegrin and metalloproteinase with thrombospondin motifs 2 OS=Homo sapiens OX=9606 GN=ADAMTS2 PE=1 SV=2
Q8C9W3	A disintegrin and metalloproteinase with thrombospondin motifs 2 OS=Mus musculus OX=10090 GN=Adamts2 PE=1 SV=2
P79331	A disintegrin and metalloproteinase with thrombospondin motifs 2 OS=Bos taurus OX=9913 GN=ADAMTS2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002127 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01562 all species →	Pep_M12B_propep	Reprolysin family propeptide	Family	Interproscan
PF05986 all species →	ADAMTS_spacer1	ADAM-TS Spacer 1	Domain	Interproscan
PF17771 all species →	ADAMTS_CR_2	ADAMTS cysteine-rich domain 2	Domain	Interproscan
PF19030 all species →	TSP1_ADAMTS	Thrombospondin type 1 domain	Domain	Interproscan
PF00090 all species →	TSP_1	Thrombospondin type 1 domain	Domain	Interproscan
PF00629 all species →	MAM	MAM domain, meprin/A5/mu	Domain	Interproscan
PF01421 all species →	Reprolysin	Reprolysin (M12B) family zinc metalloprotease	Domain	Interproscan
PF01847 all species →	VHL	VHL beta domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan
IPR036208 all species →	Homologous_superfamily	VHL superfamily	Interproscan
IPR036383 all species →	Homologous_superfamily	Thrombospondin type-1 (TSP1) repeat superfamily	Interproscan
IPR024079 all species →	Homologous_superfamily	Metallopeptidase, catalytic domain superfamily	Interproscan
IPR000884 all species →	Repeat	Thrombospondin type-1 (TSP1) repeat	Interproscan
IPR002870 all species →	Domain	Peptidase M12B, propeptide	Interproscan
IPR010294 all species →	Domain	ADAMTS/ADAMTS-like, Spacer 1	Interproscan
IPR037140 all species →	Homologous_superfamily	von Hippel-Lindau disease tumour suppressor, beta domain superfamily	Interproscan
IPR041645 all species →	Domain	ADAMTS, cysteine-rich domain 2	Interproscan
IPR000998 all species →	Domain	MAM domain	Interproscan
IPR050439 all species →	Family	ADAMTS and ADAMTS-like	Interproscan
IPR006586 all species →	Domain	ADAM, cysteine-rich domain	Interproscan
IPR001590 all species →	Domain	Peptidase M12B, ADAM/reprolysin	Interproscan
IPR024053 all species →	Domain	von Hippel-Lindau disease tumour suppressor, beta domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13723 all species →	ADAMTS A DISINTEGRIN AND METALLOPROTEASE WITH THROMBOSPONDIN MOTIFS PROTEASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008237 all species →	Molecular Function	metallopeptidase activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0030198 all species →	Biological Process	extracellular matrix organization	Interproscan
GO:0031012 all species →	Cellular Component	extracellular matrix	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_017092-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017092-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

44.1Max TPM

8.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.03	13.20
polyp at pH7 6	18	18	6.68	9.39
coral polyp · control treatment	16	16	8.12	17.36
coral polyp · oil and dispersant treatment	16	16	11.35	34.09
coral polyp · oil treatment	16	16	8.27	17.87
coral polyp · dispersant treatment	16	16	15.58	44.13
Polyp	10	10	2.50	4.58

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.20
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.43
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.50
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.77
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.21
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.68
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.36
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.28
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.93
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.88
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.87
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.67
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.66
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.38
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.17
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.45
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.18
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.39
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.87
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.74
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.53
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.52
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.16
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.53
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.48
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.24
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.10
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.98
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.79
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.75
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.47
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.38
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.24
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.06
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.36
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.56
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.55
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.52
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.32
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.68
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.38
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.79
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.54
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.31
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.28
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.14
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.42
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.48
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.26
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.39
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.09
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.82
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.76
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.76
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.97
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.48
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.17
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.25
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.95
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.36
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.00
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.92
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.69
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.68
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.45
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.31
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.87
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.11
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.05
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.50
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.06
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.27
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.88
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.84
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.35
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.33
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.43
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.02
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.95
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.00
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.13
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.81
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.85
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.08
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.30
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.16
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.41
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.36
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.32
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.53
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.39
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.93
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.72
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.94
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.98
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.58
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.92
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.60
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.54
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.26
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.01
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.03
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.91

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.