Gene detail

Detailed information of OS493_017176-T1 in Lophelia pertusa

Genomic Location: scaffold_54:1683970...1699046
NR annotation: KAJ7333633.1, cerebellar granular layer formation [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017176-T1

ATGATACACGACGAGTTTGCGTTTGACGGCTACTTGGACGATGGCGTGGAAGACGTCAACATGGCTGAGTATGTGTTGTCTCTGGCTGGGATGAGCGAGGAAAACTTTAAAGAGGCCATCACGGACCAGTACAGCGACTTATATTGGGACGAGGACCTTCTTCATGACATGTATGAGGCTGTTACAGGCGGACAACAGAATAGAAGGCCAACCTTGCAGTTCTCTGAGAGCACAGTCAGTGACATCAGTCCTCCCGATTCTATCAATCTGTCACGCGAGGAATCGTACCTCAGTATAGAACCTTTGTATTATAACTCGATCTCCAGAAGCAGCAGTGAGAGGAGCGGGACTGGGGTGAGGGACATCCTTGTGTCACCGCTAGGAGAAGCTACCGAGTTTCTGCCCATCAAGGTTATTGCCCCTGAAATGCAAGCGGACATCCAGGAATTGCTGACGCCAATTTTTGAGGACTATCACAGAGTAATGGGAGTCAAACTGGCATCGAGTGTGGAAGATCTCACTGAAAAACTGGGCACTAAAATTATGGAAATCTCCCAGCAGCTGATGTTGGAACGAAGAGCTAAGAAAAAGAGTATGAACTCCTACAACAAGATGGCGGATGTGGAGAATAAGAAAGATGTGAAAGATCTGGCGTCTAAATTAGTCAACGAAATCGAGGAATGCGATAAGAAGATTATCTACTTAAAAAATGTTCAACGACAACTGAGGAATGTATACGCTGAACGCTTTGGAGTGGATACGTCCCTGCTGTATTCATTTCTTGTGAGCTACAACAAGACGTGTGTGACGCTGGTACCGGAGTTAAACAATAACTTCCTCAATTTTTCCCCGATTTGGAACCAGAGGGTCAATGAAAGCTCGGATATCGTGGACGAGTCTCTTACTGGCCCCTCGCTTCAATCAGGGACCAAACTTGGCTTGTTATCATATCTCTTCGACAGACACGCCATGAGTCAGGCATATGTACGTTACTTCCTATACACATTCCGTTACATTGCCACAGCTAAAGAACTGTTTACCTTCATCAGGGAAAAATGCTCCGCGTCTCTTAGAACGGACTCCTCGGGCCAGGTGTATAACCATCAGCTACAGATCAGATATCGTGCACTGGACTTGCTGTCTGAGTGGATTGACGGCTACTATCAGTTTGACTTTAAAACAAATCCCAACCTTATCAAGGAGCTGCTTGCATTTGTTAAAGATGAGTTGATTCTCGTGGACAGAAGCGAAAGAGGTCATTACTTGATGGAGCTCATCTCAGAGAAACAGAAAAGGGATTTCAACAATAATTCACCGTCAGATGAGCCCAGTGATTGTGTGGCTGTACTACAGCTAGAGGATCCTCAAGGTCTCGGTCCTGTAGATGGCAAAAAAGACTCACTAAGAAAGCCATTGGGAAGTCGCAAGTCCAAATCTCCAGTGCAGTGCTTTAGAAGAGCCACGCCCGAGAAGTGCACTACATACAAACCAACACTGTACCTCAGGGCTCTGTCAGTTCTGGACCACTCGTCACGAATCCTTGCCGAACAACTTACACTGATACAGCAGGACTTGTTCTTTCGTATCCACCCAGTACATTTCTTAAACTCTCGGGCGCATGGCATCGGTGTTGGTAGAAGCCAGTCCCCCACCAGAGAACGCGACAGTATCTTTGGATTTAGTACCGGAACTCGACGAGCCTCAGAAATGCCAAGTTCGGGGGAGGGACCACCCCTCCCTTGGGAGCAAAATATGTACGTCAGTGAGCCCATCACGGATGGCTCTTTAGAAGACCTCTTGGAGCATGCGCAAGACGTGTCCTTGTGGGTGGCTGTCGAGATCTGTAGTGCGTCTTCAATAAAGGCTCAACTCGCTCTTATCACCAAGTTTGTGAATGCTGCTCGCTACTGCTGTGAGATTCGTAACTATAGTACATGCACTCAGATCGTTGACGCTCTGGAGATGTTTGTGATTCGAAATTTACCGGTTTGGAAACAAGTTCCCACTAAAACGACGGAGGCGCTGGAAGAACTTAAAGCCGTTAAGGTTATGTTGAAGACAGACAACTCGTGGTTGATGAAGAGTGAAGCGTCACGTGAGAAGCCCACAATTCCTTGCTTCATTATGTTTGTTATCCATGTGCAACAACAGGAGCTTGGAGGGTTTACGTTACCTAACGACATGTACAAATGGACCAAGATGAGATCAGCGGCTCGGTTAGTGGATCAGATACGCCTGTTTAAACAGATGCGGTACGCGTTCCAGACAGATGACGAACTGAAGGACAGACTGAAACAGCGTATAGACGAGTGCAAAAAAGAAAACTTGCATGCTCTGGCTTCTGAGAATGCTAGTAACTTCCACTTATCATCTTCACACGGCTCTAGGAAATTCCACGATGCCTTTAGGAAGATGAAAGCGGACGTTTGGGGGCCACAGTTAGACATGTCTACAACTTGGTCATCTTTAAACTCGCACCCGAATTTACGTTATAACTACATGACATTTATTTATGCGGCAGAAAAAGTTCGAATTATGATCAAATGCTTTGTAAATTGTTAA

Transcript

OS493_017176-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q76NI1	Kinase non-catalytic C-lobe domain-containing protein 1 OS=Homo sapiens OX=9606 GN=KNDC1 PE=1 SV=2
Q0KK55	Kinase non-catalytic C-lobe domain-containing protein 1 OS=Mus musculus OX=10090 GN=Kndc1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004697 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00617 all species →	RasGEF	RasGEF domain	Family	Interproscan
PF00618 all species →	RasGEF_N	RasGEF N-terminal motif	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000651 all species →	Domain	Ras-like guanine nucleotide exchange factor, N-terminal	Interproscan
IPR001895 all species →	Domain	Ras guanine-nucleotide exchange factors catalytic domain	Interproscan
IPR036964 all species →	Homologous_superfamily	Ras guanine-nucleotide exchange factor, catalytic domain superfamily	Interproscan
IPR023578 all species →	Homologous_superfamily	Ras guanine nucleotide exchange factor domain superfamily	Interproscan
IPR029899 all species →	Family	Kinase non-catalytic C-lobe domain-containing protein 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21560 all species →	VERY KIND PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0007264 all species →	Biological Process	small GTPase-mediated signal transduction	Interproscan
GO:0030425 all species →	Cellular Component	dendrite	Interproscan
GO:0032045 all species →	Cellular Component	guanyl-nucleotide exchange factor complex	Interproscan
GO:0043025 all species →	Cellular Component	neuronal cell body	Interproscan
GO:0048814 all species →	Biological Process	regulation of dendrite morphogenesis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_017176-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017176-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

45.0Max TPM

15.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.71	24.03
polyp at pH7 6	18	18	13.59	20.08
coral polyp · control treatment	16	16	18.52	29.09
coral polyp · oil and dispersant treatment	16	16	22.56	45.02
coral polyp · oil treatment	16	16	13.79	24.24
coral polyp · dispersant treatment	16	16	15.47	27.30
Polyp	10	10	9.55	21.86

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.03
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.49
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.63
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.49
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.78
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.69
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.59
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.38
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.34
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.40
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.33
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.99
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.67
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.13
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.00
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.78
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.63
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.43
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.08
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.62
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.32
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.06
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.03
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.19
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.72
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.42
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.21
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.26
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.85
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.56
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.02
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.50
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.98
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.31
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.73
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.09
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.82
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.54
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.07
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.90
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.05
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.48
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.24
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.59
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.56
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.22
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.55
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.54
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.15
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.02
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.43
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.58
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.89
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.16
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.12
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.46
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.15
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.90
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.56
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.17
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.07
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.79
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.72
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.17
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.24
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.12
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.78
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.16
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.20
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.80
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.20
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.57
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.35
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.19
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.91
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.63
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.66
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.55
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.40
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.30
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.41
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.66
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.41
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.79
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.62
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.51
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.11
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.77
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.77
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.66
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.62
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.44
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.09
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.74
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	21.86
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.72
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.69
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.81
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.80
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.83
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.55
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.52
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.20
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.53

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.