Gene detail

Detailed information of OS493_017178-T1 in Lophelia pertusa

Genomic Location: scaffold_54:1703815...1728788
NR annotation: KAJ7333635.1, cerebellar granular layer formation [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017178-T1

ATGGATGTACGTCGGGTGCAGTTAGAGCAAGATTTCCCTTCAGTAAAGTCACCGCAGAGAAAAATTAGCGCTCCACTTCCTACGAGAAGCGTTGATCCACCACCCCAGAGGAAGACCAGCGTGAACGTGATCAAACGTTCGCCTGTCACCTTTGTAATCTCAAACGATAAAGGTGGAAGAACAGAAGGGACGAGAAACGCCTCGGAGTATCAACCGCCAAGTGGTGTGAGCTTCATGAATTCGCGATTCGTTCCATTAAACCAGGAGGAGGCCGAAGATTATTCCATGATGAAAAGAGCGGAGGCACGTAAATCGTCCACTGTTACAATGAGTTCAACAGTCACTGTTCATGGAGGAAGTGCGGGAAGTGGCGTCGTGCGAAAACTAGGAATCAGTGCTCTGCAGCAGCCTCCTCTCAATGATTCTCTTCCCACAGAGGAAAGATTTGCAGCACTCAGTGAGAAGTATGCCTCGTTAAAGGCGAAAATTGGAGCAAGTGACAGTAAGCAGAAAAATCAAGATTCTTCTCCCAAGCCAGTTGAAAAGAGTGATTATGGTCAAAACACTGAAGATAAACTAACCCAGTCGAAATGCTGGACAACTGTCGAAAGCATTCAAGTACAAAACTTTGAAGATCGAGTCTCTGACACTCGTGTTAACTTAGCGCAGGTGGAAGCCGAAAGTACATTGATTACCGAAGATGGAGGTAAGCAGAAAAAAGACAGCGAAGAACATGGCATCCATAGCAGCCGAATGACAATCACGAGTAGTGACGTCAACGATATGGGGGTCATTAAAACGACAAGCAACATGAAAGAAAACAACATTGAGAACATCGACGAGAACAACAATAGCAAGTACAGTATCACCAAGATACAAGTCGAAAACGATGAAATACAGACCAGTTCTTCCATAGTTAATGGTAAATCAACTCTCCACTTGAGACCCGAGTCTCCTGCTCAAAGGTCGAGGACAACCGTTGTAGCTAAGCTGATGAACAGAAAATTGGGTCCCAGAAGAAAGCAAAGCATTGTTCCACATGTGGCGAAAAGACGGTCAAAGGTTTACACGGAGAATGCGCAGTTCGAGAAGATCAGAACGGTTGTTGAAAACACCGTGCTCCGTGCACCGGTACGACAGCAGGCGTTGACTATCCAAGAGCTGTTGAATGGCCTCTCTTCCTGCTTGACTGAAGGAGAATTGGTGGCCATTTTCAAGGAGTGTTCCAAGACGTTACGGACCCTGGATGCGCTGGGGAGTTTGCCTTCTTACGTCTCCTTGGAGTCCGTGATTATCAACCCTAGTGGAACTATCAAGTTCAAGCATCTTAGCACAGGAATTTCCATTGATGATCTGTACTTGGCCCAGAATATTCCAACAAATTTGCATCCGAGAAGAGGAGCCGGGCGATTAAAGCGAGTGACGTCATCGACGCACGAAACCTTTACATGCGTTTTCAGCCTGGCTGCCACACTGTGGTCAGCGGCTGACTGGCGGTTGACAGAGGCAGAGAAGCCATCGTTAAGTCCCAGATTCCAAGAGCTGCTGGTATCTATGACAGACGATGCCCCGGATGCCAGGCCAGGCTTATATGATGTACTACAAACATGCGAATCCTTACAGACCGAAGGTGATATGACGTCACGAGAAAGATGCCAGGCTTTGCTATGGGAGTACCAGGCTTCCGCGGCCATGGAGAATGATGATGTAAGGGACTCACCACCAAGAGAAAAAACAGTGGAAGAGGATAAGAAACATCATGACACTCTCATGGGATCCATCTCAGTGGCAGCTTCATTCAAAGGCTTTCTTAAACAAACGGCAAAGCCTCAAGAACGAAATCCCTTTGTCAAGACTCAAAACAAACCGGAACCGTCCAATAAAATCGATGGCAATTCGGCTGGGGAAATATTAACAAATAAAACGATTTACAAACCAGAAAAAGTTAAAGCGGAGAAGAATATAATCGTTGAGAATTCACCAAAGCTGAACGTCACCACTATCAACTCTTCAAACAGCGATAAGGAAATTCCCTCATCTGATTCATCAAACGTCAAGGCTGCCACTGCATCTGATGCAAATAACAACCAAGATCCCGCCAGAGATCGTAAACGGGGCGCTTCACTAACCGAAGATCAAAAAGAACAGCTTTTGTCTCTTCTAGCATCAACCAAGCTGAACAAAAGCCCTTTCTATACAGGTGATAACGACCGTAGAAGTGAGGTATCAAGTAAGCCAGTAGAGGAGCAGTCCATTAAGCCTCCTTCTCCTTCCTTGTATGCTTATCCACACTACGGCCAAACCGAAGCTCAGATGATGTTCAGTCCTATAACCCCTGCTGGTCGTTCGGTCTCTCCAAGCGTACACTCCGATATAAGCGAAAACCAAATACCTTCCGTCCCTAATGCCACATTTTTGCCTATCGCTGTTCCCGTCCCCAGCGTAACTCCAGTGGTGATGCCCCCTTTCTGGTACATGCCCCAGGGAGGAATGATGCCGTATCCTCAAGCAGCCATGTCCCCTGTGCCATATGTTCCGCATGATCCGTCAGTGACTTCCAACCAGTCAGTGGTGTCAACAGATAGTAGTGATGTCAGTGAGGTTTCTGACGCGGACCCTCGACCTAAGAAAACAAGCAGCGCAATGCCAAGGTTTGATAAATCTGAAACTTCAAAGTCAAACACAGAGCAGAGAACGAGGTGTTCTCCTGCCCTCCAGAATAACAAGGGTTCTAAGCTTCCTCGTCCCACTTGGAAAACACCAGTTGCGAAGGGCAGAACAACACCAGTTGAAGCAGAAGCGAATTCCAATGTTGTTCGACGAAGGGTATCAATTACTGATGAATTCAACGAGCAGAGTGAAGATACCAAACCAGTTCGTGCAAGAACTCCTTCTCCTTCCTTGGGCAGACGAGCGTCTCCCAAAGCGGTGACTCCTCCTCGCTCCAAAACGCCTCCCGTGTACTGGAATAGAGAGGGAGTGGATATGCCGACCAATAATAAACCGCACGGACGAGCATCAACGGGCTCTTTATCAAACAGTCCATCTAGCTCACCGGATAGACGGAGGAGATCGAGCACTTCTCCGTCAGGATCGGCACCAAACAGTCCTGCGCAGAGATCCAGGAGCCAGAGTAGATCATCCAGTCCTGCAGGATCGCGATCCAACAGTCCCGTTTCTATGCTCGTGTCAAAGTTCGAGCAGATATCTCAGGAGTCTACAGAAAAACTGTCCACGTGA

Transcript

OS493_017178-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004697 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_017178-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR011019 all species →	Domain	KIND domain	Interproscan
IPR029899 all species →	Family	Kinase non-catalytic C-lobe domain-containing protein 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21560 all species →	VERY KIND PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0007264 all species →	Biological Process	small GTPase-mediated signal transduction	Interproscan
GO:0030425 all species →	Cellular Component	dendrite	Interproscan
GO:0032045 all species →	Cellular Component	guanyl-nucleotide exchange factor complex	Interproscan
GO:0043025 all species →	Cellular Component	neuronal cell body	Interproscan
GO:0048814 all species →	Biological Process	regulation of dendrite morphogenesis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_017178-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017178-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

104TPM > 0

7Conditions

7.0Max TPM

1.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	1.13	2.17
polyp at pH7 6	18	17	1.21	2.05
coral polyp · control treatment	16	16	2.37	4.48
coral polyp · oil and dispersant treatment	16	15	2.43	6.97
coral polyp · oil treatment	16	16	1.07	2.58
coral polyp · dispersant treatment	16	16	2.73	5.50
Polyp	10	7	0.20	0.49

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.17
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.67
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.49
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.45
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.39
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.36
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.25
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.10
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.06
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.04
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.89
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.88
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.84
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.83
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.53
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.48
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.05
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.85
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.69
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.66
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.60
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.52
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.42
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.26
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.25
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.18
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.04
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.87
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.66
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.64
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.44
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.34
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.21
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.05
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.04
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.45
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.32
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.15
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.14
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.04
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.18
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.56
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.53
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.46
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.34
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.97
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.53
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.90
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.57
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.99
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.70
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.65
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.16
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.09
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.65
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.27
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.18
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.90
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.22
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.58
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.27
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.76
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.54
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.29
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.26
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.21
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.06
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.80
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.71
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.71
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.66
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.54
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.52
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.14
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.11
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.50
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.72
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.71
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.45
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.97
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.91
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.80
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.77
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.67
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.25
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.09
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.08
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.18
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.07
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.49
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.47
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.33
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.33
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.29
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.10
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.03
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.