Gene detail

Detailed information of OS493_017304-T1 in Lophelia pertusa

Genomic Location: scaffold_55:818611...835716
NR annotation: KAJ7391607.1, hypothetical protein OS493_017304 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017304-T1

ATGGCTGAACAAATTTCAAGTTTTCGTCTCTTTCTCAACAAAATATCCAACGAATTAATAACTGAGGAGCTTGACAGTTTAAAATTTCTTTGTATTGAAATTTTAACCAAAGCAAAGTTGGAAACAATCAAGAATACCAAGGAACTTTTTGTGGCCATTTTCGAAGTAACCACAGGCGAGGAAAAGCAGCTCAACTTGTTGAAACAACTGTTTAAAAATATTAGCAGATTGGATTTAGAGTCTCAAGTTGAAACATTTCAGGAATCGAGAAAAGATGCTGGGCAACATGCACAGGTAGATGCTGATAATAGGGTTAATGACAACAGAGCCCTGGCACCTTTGCAATCTAACTTTAGCAGCCAGCCAATTCAACCAGGAAACTCAGTACAGCAAGTAGAGCCTTCTTTACAGCCTGGTTATGCAGCATCTCCACAGGCCATGTCTGATTTACTTGCACATCAAGCTATGCAAGTTGAACCAAGACCAAGAGTCCTACATTCTTCAGATCACATCCCAGATCCAAGGTTTAAACTTCCAACTGAACTAGAATCTGCACCAGGAAGCTCGGTATTACAAGTAGAGCCTTCTTTACAGCCTGGTTATGCAGCATCTCCACAGGCCATGTCTGATTTACTTGCATATCAAGCTATGCAAGTTGAACCAAGACCAAGAGTCCTACATTCTTCAGATCACATCCCAGATCCAAGGTTTAAACTTCCAACTGAACTAGAATCTGCACCAGGAAACTCGGTATTACAAGTAGAGCCTTCTTTTGTACCCTTGGATTATGCAGCATCTCGACAGGCCACAGATGTTTTGCCTCCACTCACACATCAAGCTATGCAAGTACATTCTTCAGGTCACACTCCAAATCCAAAGGAAAAGTTTAAACCTCTAACTGAACAAGAATCTGCCCGGAAGTACCATTCTCAACCCAGTGTTCCATTTGGGCAACAAGAGCAGCCCTCCACCAAAGAAGACGAAAATTTTCAATGGGAAGAGGTACAAGATCGTCCACAATATTCACAAAACAGCTTATATTTCAGCTCTGTGGGAACGTCTGAAGATTCAGGTCAGCATATTGGTCCAGAAAATGAAGCCCAAAATGGAGTATCAAATGGTAGAGATGATCCAGATCGAGGCAGATCAAGGACAGATGGTTTAACTGCAAACACCACCTCTGGTCAAAATCCAAGAATTTCTCAGTCACATGCAGAAAAAGTTCCAGTAGAAAGAGTCTCGTCAAATGATTATGACGTTGAAGCTGCCCAACATTTACACCAGAAATGTCCAGTGGAGATGAGCTATAACTGTATCTCAAGGTACTTCAACAGCAGTGGAAAAAAACTGGGGGAAGGTGGCTTTGGAATTGTATATTCAGGGACCCATCCATTTCATGATCAGAGTGTTGTTGTCAAAGAAGAGTACAGCTCTCATCTTGGACAAGCTTACAGTGCAGTACAATTAAAAAGGGAGAAACGGGTTGGTTATATAAAACATCCCCATCTGTTGCCTCTTTATGCATTTTGTGAGGAGAAAGGAAAACCTCGTTGTTTGATGTATCCTAAAATGCACAGTGATTTACACAGGGCCTTACGTAAGGATTTGCAGAGAAATCAAAGGTTACCGTGGGAGGATAGAGTAAGGATTGCCCTTCACACTGCTAGGGCACTGTTGTATTTGCATACTGAAGTCACAAATGAGAGAAATGTCAGACAGGAAATTGTACACATGGATGTAAAGCCAGGAAATATATTCTTAGATGAAGACTTTAATGCACGTTTGGGGGACCCAGGAATGGCACAGGAGTTGCCCATGGAATACTCTTATGCCTCTATTAGCCAGATTCGTGGAACAGAGGGGTACTTAGATGAATACCTTCAAGATAGACACTTTAAACCTGTCAACGACACTTTTTCCTTTGGAGTAGTGCTGTTACAACTTCTTACACAGAGGAAAGCTGTTGAAAGAGTTCCACCAAACAAGAATGTGCAGCAGCCTTTATGTCGTACTTTGAAGAAAGACGGATTGTTATCAGACCCAGAAAAATTAATGGAAAAGGCGCAACAGGGTGTTTGGCCCGATAGTGGAGATGACAAGAACTACACCAAGGAATTTGCTGCTATTACCATAGACTGTCTGAAACCACCAGACGAGAGAGCTAAGCTGACAGATGTTTGTAAGAGGCTAGAGGGAATACTGGAGAGGAGAGGAGTCAGTAAGGCTTCAAAGCCCAAAGAAGGAGCTCGTTGTGTGTCTTGTCTACTCAACTATCCAGCAAAGTACTTGGGAGTGAGGTCCCGTGGTTGTGATGCTGATATCCATCAGGAATGTAATTATTTTTGTGCGACGTGTTTAACACAAGCTCGGCGTAACCCTCTGGAGTGTCCATCTCATGGGCCAGCTGAACCTCCTATAGGAGGATCTGACATATATGCCGTTCTGGTATGTGGTAATGACCCTGACACTCCACAGGCTGCTGCAGTCTTTCAAAGAGATTTAATTGGCTTTAAAAGTGTTCTGACAGACAGTCGTATTGTTGGAGTCAGGAATGACCACATATTTAGTATTACACCTTCGTCATCATGTGGCACGTCACAAGCCACTCGAGTGAGACAAGCACTTCAGGAATTAAAACAGAAGCTGCTAGGAAAGAAAGATGTGTTTCTATACTTTTACTTCTCTGGCCACAGTGATCAGAGTGGTAACTTGTTGTGTTCATCAGAGAAGGACCGTCTTACAGAGGTCGAGTTGAAAGAGCACTTCAGACATCTCAATGTCAATGAATTCTTGATCATTTTGGATTGCTGTTATGCAGATGGCAAGATTGCTTCTGAACATATTGAAGATGAAAGTTTTCTGGTGCACAAGTCTCCTGATCCTGCAGCAGAACCTGCAGCAGAACCTGCAGCGGAACCTGCAGCAGAACCTGCAGCAGAACCTGCAGCAGAACCTGCAGCACAAATGGCATCCTGGCAGCATCCACTGCAATCCCTATGCAGTAATCTTCAGGCGACAAGTGGTGATGGAAATTTGAAGGAACCTATTTCAAATGCTGCAGTGGACGTAACTGACACTGATTTTGATACGTTAGATGGCAACGTGTTCAACAAGGCTCCACTAGTGCCATTCACAGTACGCCAGTGGTCCTCATCCTTAAGTCAGCAAGAATCGTATGCAAGGGCTAAAGGCAACAGCTTTTTGACGCAGTTCATAATTTGTGGGTTACGTGGTGCACACGAGTGTCCCTTCTCAAACTGCTCATCTTGTGATACATTCAAAGCTCAAGCCAAATCTTTGGGTTACATTAAGGCTGCCAACTTAGAAGACTTCATTTCCAAGCATGTAGAGAAAGCTGCTTCAAGAGCTGGTGGACGGCATCAAAGTCCACGCATGCGAACTGTGCATTCCAAGGAGACAGTACTGGCTTTCTACAGTGAAGAAATCTTGCATGACGAGATAATGTTCAGATCGACCTCCGCATTCTATCAAAGAATCACCATTGACAAGTTTCCCCTTTTACTTTTGGAATTTCAAAAGCTGGTGTTTTCAGAAGTTAAAGGACACCTTCCCATTTGTGCTCAGCCAAAGCATCTTCAGATTCTTTGTGACGATGAAGAAATCGATGCAGCATCATTTATTGACCTCCAGGACTTCCTCAGACAAGGATATGACGTCAGATGCCAGTTGAGGCCTTGTTCTAGCATTGTTAATGGCCCAGTAGTTGTTCAGATACAGAATTACAAGGATCAGGTCATAACTCTTCTGACTTCACTTCAGTTGTCAAGAAACCAGCTGGAGGACCAGGATACCTTTGAGATGGACACCACCCAGAAAACATACACTGCAGAAGATGTCAGAGAGTGTTGTGAGGACCAGCCAAGCCTCTATGATCTGAAGGACACTTCTGTTGGAATCTCAATTGTTGTTATCCTGACGGAAGCATCTCTGTACCCAGGGAATTTAACGATATGTGTTTTGGATGACAGCATAGATTGCTGTTTTGCCAAGGCTTCAAATTAA

Transcript

OS493_017304-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9LRP3	Probable receptor-like protein kinase At3g17420 OS=Arabidopsis thaliana OX=3702 GN=At3g17420 PE=1 SV=1
Q93ZS4	Protein NSP-INTERACTING KINASE 3 OS=Arabidopsis thaliana OX=3702 GN=NIK3 PE=1 SV=1
Q9CAH1	Putative receptor-like protein kinase At1g72540 OS=Arabidopsis thaliana OX=3702 GN=At1g72540 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0012119 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01335 all species →	DED	Death effector domain	Domain	Interproscan
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001875 all species →	Domain	Death effector domain	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR011029 all species →	Homologous_superfamily	Death-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR27001 all species →	OS01G0253100 PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0042981 all species →	Biological Process	regulation of apoptotic process	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_017304-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017304-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

36.5Max TPM

15.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.60	19.75
polyp at pH7 6	18	18	12.69	19.39
coral polyp · control treatment	16	16	20.52	36.46
coral polyp · oil and dispersant treatment	16	16	17.92	25.36
coral polyp · oil treatment	16	16	18.00	22.96
coral polyp · dispersant treatment	16	16	12.73	18.53
Polyp	10	10	10.04	15.72

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.75
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.21
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.53
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.18
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.62
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.08
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.97
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.42
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.09
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.59
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.28
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.03
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.42
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.69
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.18
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.04
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.39
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.92
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.58
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.47
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.05
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.69
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.69
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.30
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.88
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.83
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.06
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.25
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.87
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.79
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.36
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.39
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.46
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.74
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.63
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.47
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.16
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.02
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.20
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.80
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.12
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.92
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.00
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.42
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.17
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.04
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.97
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.25
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.36
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.14
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.05
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.73
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.03
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.80
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.45
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.35
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.32
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.95
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.72
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.16
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.89
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.80
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.11
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.96
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.39
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.33
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.76
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.55
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.17
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.58
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.48
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.85
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.58
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.45
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.22
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.65
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.42
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.95
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.53
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.03
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.81
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.61
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.82
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.98
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.90
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.97
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.95
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.84
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.70
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.71
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.61
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.27
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	15.72
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.20
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.11
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.50
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.25
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.48
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.32
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.53
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.39
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.87

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.