Gene detail

Detailed information of OS493_017391-T1 in Lophelia pertusa

Genomic Location: scaffold_55:1877139...1922724
NR annotation: KAJ7391694.1, hypothetical protein OS493_017391 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017391-T1

ATGTCTACCTCTGATAATGATTCAGATGTAAGTGAGGACGGAATTTCGTTCAAATTTGACTCCAAAGGTTCTAAAGACTGCAATGTAATTGCCACACCAGCTGAATTTGTTAAAAGATTTGGTGGCTCACGAGTTATAGAGACAGTCTTGATAGCCAATAATGGTATTGCTGCTGTGAAATGTATGAGATCTGTTAGACGTTGGGCCTATGAATTATTTGGCAATGAGAAAGCTATACGGTTTGTTGCAATGGTCACGCCAGAGGACCTTCGGGCCAATGCAGAGTATGTCAAGATGGCGGATCAGTATGTGCCAGTTCCAGGTGGATCAAACAACCATAATTATGCCAACGTTGAACTAATTCTGGATATTGCAAAAAGAATTCCTGTACAGGCTGTTTGGGCTGGATGGGGTCATGCCTCTGAGAATCCAAACTTCCAGACCTCCTCTCAAAGCATGGCATCACTTTTATTGTCACTTCTTAATTCTTACACTGGCCTATACAAAGATGAAGATCGAAGTCCTCCTGCAGCAGCTATGTGGGCTCTTGGCGACAAAATTGCATCAACTATAGTTGCTCAGACTGTTGGTGTACCCACCCTCCCCTGGAGTGGAACAGGTCTTACTCTTGATAAGTCATCTAAAGACATTGTTGACGGGAAAGTTGTAGGAGTGTCAGAAGATCTGTACATGAAGGGGTGTGTGCAAGACGTCAGTGCAGGAATCAAGGTTGCCAGAGATATTGGCTACCCTGTGATGATCAAAGCCTCTGAAGGTGGTGGCGGTAAAGGAATCCGTAAAGCGTCCAGTGATGATGAGTTTACAAACTTTTTCAGACAGGTCCTAACAGAAGTACCTGGTTCTCCTGTGTTTGTGATGAAACTGGCCAAAAATGCAAGGCATTTAGAAGTACAGCTATTGGCTGATGAGCATGGAAATGCAATGTCCATTTTTGGAAGAGATTGTTCAGTGCAGCGTAGACATCAGAAGATCATAGAGGAAGCACCAGCTGCTATTGCTAAACCTGACGTCTTCAGAAAGATGGAAGAGGCTGCAGTGAAGCTTGCTCGCCTCGTGGGTTATGTCAGCGCAGGAACTGTGGAATATCTATATCATGCTGAGGATCACACTTTTCACTTCCTTGAACTCAACCCAAGGTTACAGGTTGAACATCCATGTACTGAGATGGTTTCGGACATAAACCTTCCTGCAGCCCAACTTCAGGTTGCAATGGGTATTCCATTGTACAACATCAAGGATATCAGAACAATGTATGGTCTGGATCCCTATGGAAAGGATCCCATAGATTTTGACAATCCGATGAACCTTCCCAAGCCAAAGGGACATGTCATTGCAACTCGCATTACTTCAGAGAATCCAGATGAGGGCTTCAAACCCAGTGGTGGTACAGTAAAAGAGTTAACATTTCGTAGCATGAAAAACGTCTGGGGTTACTTTAGTGTAGGAGCTGAAGGTGGTCTTCATGAATTTGCTGACTCTCAGTTTGGCCACTGCTTTGCTTGGGGAGAGGACAGAGAAACAGCAAGGAGGAACATGGTCTTGGCCTTGAAGGAAATCTCTATACGTGGTGATTTCCGTACAACTGTGGAATACCTGATCCAGTTGTTGGAACATGAATACTTTTCAAAGAACATAATCGACACTGGCTGGTTGGACTTTCTAATTTCTAAGCAAGTTCAGACGGAACGTCCTGATGCAATCCTTGGTATTATTTGTGGAGCTGTTCATGTGGCAGAAGCAGGCATAAGCAAGAGATATGTCAACTTCAAGTCTGCTCTGGAAAGAGGACAGATCCTTTCAACAGGTTGTTTAGCAAACATTGAAGATGTTGAACTGATTAATGACGGATTCAAGTATTGCTTAAGGGTATGCAAGTCAGGACCAAACACATTTTTTCTTGATATGAATAATTCCTGGACAGAAGTGGACGCTCACAGAATGAGTGATGGAGGATTACTTTTGTCATGGAATGACAGCAGTTACACCACTTACATGAAGGAAGAAGTGGACAGCTATAGGTTGACAATCAGTGGGAAGACTTGCATCTTTCAGAAGGAAAATGATCCTACAGTTTTGAGATCACCTTCTGCTGGAAAGCTTATCCAATTCGTCGTTGAGGATGGAGGCCATGTCTTTCAGGGAGAGGCTTATGCCGAGATTGAAGTAATGAAGATGGTTATGCCATTGACAGTCAGTGAAAGTGGTTGTGTGCACTATGTAAAGAACACTGGAGCAGTGTTAGAGCCTGGTTCAGTTGTGGCCAAGTTGGAACTTGATGATCCAAGTAAAGTTACACAGGCACAGCTCTATACTAGTCAGTTTCCTCAAACGTCTGAACCTAAACTGAAAGGAACTAAGCTGCATCAGATTTTCCAAGTTGCCCGCGAGAATCTTCAAAACATCATGGATGGGTACTGTATTGGGGAACCACATTTTTCACAGAGGCTGGAGGAAAATGTTAACACACTTATAAGGGCTTTGAGAGACCCTGCATTGCCGCTGTTGGAATTACAGGAAATGATCTCATCCATTTCAGGGCGTATTCCAGTGACTGTTGAAGAAACCATAAGGAGACATCTGTCAAACTATGCGAGTAATATCACATCTGTGTTGAGCCAGTTTCCTAGTCAACAGATCGCTAATGTTGTTGATGCTCATGCAGCAACTCTAACCAAGAGAACTGAACGAGATGCATTCTTTCTGAACACACAAAATATTGTACAACTTGTCCAGAGGTATCGCAATGGAATTCGTGGACATATGAAGGCGGTTGTCTTGAGTCTGTTGAGGCAATACTTACAGCATGAAGTACTTTTTAATGAAGGAAATTTTGAAAAGTGTGTAACATTGTTGCGTGACAAGAACAAGGCCAAAGATCTTGCACCAGTTGTGCAAAGCATATTTTCTCATGCTTCTGTGTCCAACAAAAACCAACTGACGATAATGCTAATAGACCAATTGTGTGGACGTCAAAGTGGTTTGTCAGATGAACTAAACCATATTTTACAAGAACTTACCACACTCAATAGACACGACAATGCAAAGGTGGCACTTAGAGCAAGACAGGCCTTGTTAGCTTCTCAGCAACCATCCTATGAACTTCGTCACAACCAAGTTGAATCACTCTTTCTCTCAGCCATTGACATGTATGGCAACCAGCTGGCTTCGGACAGTTTCCAGAAATTGATACTCTCAGAGACTGCTATATTTGACATTCTTCCAAGCTTCTTCTATCATTCCAGTGAAGCAGTGAGGACGGCAGCTCTAGAGGTTTACATCAGGCGTAGTTATCAAGCCTATGAACTCACCACACTATATCACGAAAAGGTTGAGGAAAATGTCTTGATTGTGCAATTCCAGTTCATTCTACCAGAAGCACATCCAAACAGGATGCTACAGAGAGTTCCTTCTAGTAGAACTGTTCTTGCCATGCCAAGGGTCCGCAGTCTCAGTGAGGATATGTTTGACCTCATCAACCAGCCGCCTTTGAAGCCATGTCAGAGAACTGGTGTCATGGCGGCATTTCCGTCCATTCTTGAATTTGAAAGAAATTTTGATGACATCATGAACCGTTTTGAGCCACCAACCCCTGATCAGCTGTCACCATCGCCCATGGGAAGAAAGATAAACCTTGACCCTGTGTGGGAATCTGAAAATAGGACAGAGCCTGGAGCTGCAAAGGAAGAAGAACCGATACACATCATTAACATTGCCTTGCAAATTGAAAAGAATTGCAAAGATGTGGAAATTTGTCGCAAGATGGTGTACGAGTTTACTCAGTCCAAGAAAGAGATTCTCAAGGACAAGGGAATCAGGAGAATTACTTACTTGCTAAGTGATTGCAAGGGTATGCTCCCATGGTTCTTTACCTTCAGAGCTCGGGACGATTTTGTAGAGGATTCCATTTATCGTCATTTGGAGCCAGCGCTTGCCTTTCAGTTGGAGGTTAACCGTCTACGAAACTTTGATTTGGAGACAATTCCTACCACAAATCACAACATCCATTTGTACCTAGGCTCCGCCAAGAAGGTTTCAGCTCAGTCAGAAGTCACCGACTACAGGTTTTTCATCAGGAGCATTGTGAGGCACTCTGACTTCATCACGAAAGAAGCATCATTTGAATATATGGAGAAGGAGAGTGAGATTCAGCTCCTCGAGTCCTTAGATCAACTGGAAGTTTGTTTTTCAGAGAGTGTCAAGAGGACAGATTGTAATCACATTTTCCTTCACTTTGTTCCCTGTGTCATCATAGAGCCCAATAGGATTGAAGAGAGTATCCGTCACATTGTCACAAGATATGGTAGACGACTTTGGAAGCTGCGTGTTCTTCAAGCTGAAATGAAACTCACTATCAGGCTCACACCCACTGGAAAACAGATTCCTCTGCGGATATTTATTGTCAACGAATCTGGGTACTACCTAAGCTTCAATATTTACCGGGAGATAACGGACCTAAGAACAGGACAGATAGTTTTTGAGTCCTATGATCAGAAGCAGGGTCCGCATCATGGCCTTCCTGTTAGCACACCTTACGTCACCAAAGATCATTTACAGTTGAAACGCTTTTCTGCACAGTCTCTTGGAACCACCTATGTGTACGACTTCCCCGAACTTTTCCAACAGGCCATCATTCGACAGTGGAAACAATGGTGTAGTGAAAACAAGGACGCTAAAACTCCGTCAGATGTTCTAAAAGTGACCGAGTATGTTTTGGATGAAAACGACCAACTGATGCCAATGAGCAGACTGCATGGAGAGAACACTATTGGCATGATAGCATGGAGACTGAAGTGTCTGACACCGGATTGTCCAGAAGGACGTGAGATTATTGTAGTTGCCAATGACATCACGGTTATGATTGGCTCATTTGCACCCCAGAGGACATGCTTTTCAAGTGGGGCTCGCATTGGACTCGCTGAGGAAGTGAAGCATCACTTTAAAGTGGCCTGGAATGATCCTCTTGCGCCTGAGAAGGGCTTCAAGTATCTGTATGTTACTCCCAGTGACTTTAAAAAGTTAAGTGCCACTAACTCCATGCACGCTGAACTGATTGAAGATGATGGCGAGTCCAGATACAAAGTCACCGATATTATAGGTCGTGATGATGGCATTGGAGTGGAAAACCTTAAAGGTTCTGGAATGATCGCTGGAGAGATGTCCGCTGCGTATGATGACATTGTAACAATGAGTCTTGTTACATGTCGAGCAGTTGGTATTGGTTCGTACCTGGTTCGTCTTGGTCAGAGGGTTATCCAAGTGGATACAGCCCATCTCATTCTCACAGGAGCTGGAGCTCTAAACAAGGTTCTTGGTCGCCAAGTGTATACCTCAAACCTTCAATTGGGAGGACCTCAGATCATGCACAACAATGGTGTGACACACATGGTGGTTTCTGATGATTTTGGAGGAGTCTCCGCCATCATGCAGTGGCTTTCATATGTTCCAAAGTGCAAAAATGGTCCTCTGCCAATTTTAAAGATTAGTGATCCTGTTGACAGGGAAATTGAGTTTGTTCCTCCAAAGTCTGCGTATGATCCACGTCACTTCATCTGTGGAGCACCGCACCCGACAATAAAGATGTTTGGCTAA

Transcript

OS493_017391-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P11029	Acetyl-CoA carboxylase OS=Gallus gallus OX=9031 GN=ACAC PE=1 SV=1
Q5SWU9	Acetyl-CoA carboxylase 1 OS=Mus musculus OX=10090 GN=Acaca PE=1 SV=1
Q28559	Acetyl-CoA carboxylase 1 OS=Ovis aries OX=9940 GN=ACACA PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002167 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02785 all species →	Biotin_carb_C	Biotin carboxylase C-terminal domain	Domain	Interproscan
PF08326 all species →	ACC_central	Acetyl-CoA carboxylase, central region	Family	Interproscan
PF00364 all species →	Biotin_lipoyl	Biotin-requiring enzyme	Domain	Interproscan
PF21385 all species →	ACCA_BT	Acetyl-CoA carboxylase, BT domain	Domain	Interproscan
PF00289 all species →	Biotin_carb_N	Biotin carboxylase, N-terminal domain	Domain	Interproscan
PF01039 all species →	Carboxyl_trans	Carboxyl transferase domain	Family	Interproscan
PF02786 all species →	CPSase_L_D2	Carbamoyl-phosphate synthase L chain, ATP binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005482 all species →	Domain	Biotin carboxylase, C-terminal	Interproscan
IPR005479 all species →	Domain	Carbamoyl-phosphate synthetase large subunit-like, ATP-binding domain	Interproscan
IPR013815 all species →	Homologous_superfamily	ATP-grasp fold, subdomain 1	Interproscan
IPR013537 all species →	Domain	Acetyl-CoA carboxylase, central domain	Interproscan
IPR000089 all species →	Domain	Biotin/lipoyl attachment	Interproscan
IPR011762 all species →	Domain	Acetyl-coenzyme A carboxyltransferase, N-terminal	Interproscan
IPR049074 all species →	Domain	Acetyl-CoA carboxylase, BT domain	Interproscan
IPR016185 all species →	Homologous_superfamily	Pre-ATP-grasp domain superfamily	Interproscan
IPR005481 all species →	Domain	Biotin carboxylase-like, N-terminal domain	Interproscan
IPR011761 all species →	Domain	ATP-grasp fold	Interproscan
IPR029045 all species →	Homologous_superfamily	ClpP/crotonase-like domain superfamily	Interproscan
IPR049076 all species →	Family	Acetyl-CoA carboxylase	Interproscan
IPR011054 all species →	Homologous_superfamily	Rudiment single hybrid motif	Interproscan
IPR034733 all species →	Domain	Acetyl-coenzyme A carboxylase carboxyl transferase subunit beta	Interproscan
IPR011053 all species →	Homologous_superfamily	Single hybrid motif	Interproscan
IPR011764 all species →	Domain	Biotin carboxylation domain	Interproscan
IPR001882 all species →	Binding_site	Biotin-binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45728 all species →	ACETYL-COA CARBOXYLASE, ISOFORM A	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0003989 all species →	Molecular Function	acetyl-CoA carboxylase activity	Interproscan
GO:0006633 all species →	Biological Process	fatty acid biosynthetic process	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_017391-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017391-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

17.2Max TPM

7.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.08	13.34
polyp at pH7 6	18	18	7.63	11.85
coral polyp · control treatment	16	16	9.74	17.16
coral polyp · oil and dispersant treatment	16	16	6.35	12.57
coral polyp · oil treatment	16	16	7.20	14.31
coral polyp · dispersant treatment	16	16	8.29	13.05
Polyp	10	10	2.67	5.53

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.34
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.52
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.82
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.12
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.04
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.81
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.74
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.07
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.02
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.83
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.16
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.68
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.45
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.37
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.17
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.15
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.65
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.85
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.65
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.27
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.87
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.61
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.49
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.82
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.05
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.35
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.24
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.18
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.85
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.70
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.53
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.81
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.18
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.96
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.16
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.88
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.13
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.65
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.72
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.41
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.08
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.76
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.65
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.06
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.56
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.97
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.01
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.25
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.57
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.09
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.96
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.29
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.05
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.74
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.38
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.10
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.57
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.44
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.10
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.13
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.07
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.31
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.31
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.02
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.85
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.67
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.79
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.33
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.73
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.25
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.22
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.46
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.21
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.72
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.51
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.59
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.49
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.05
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.05
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.92
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.38
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.26
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.14
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.18
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.15
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.46
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.09
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.72
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.32
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.93
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.26
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.83
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.77
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.21
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.53
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.47
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.04
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.23
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.49
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.34
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.37
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.87
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.80

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.