Gene detail

Detailed information of OS493_017578-T1 in Lophelia pertusa

Genomic Location: scaffold_56:1942806...1959052
NR annotation: KAJ7385200.1, spindle assembly [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017578-T1

ATGGAGGGAGAGTACGATCTCGCTAAACAACTGCGAAGTTGGGCCTTGGATGAAATGCGATTTAGACCACAAGGGCGACACATTAACACCCCTCTTCCAACGAAAGAGGACTTTAAGATGTTATGTCGTGGAGCCATGGTGGATGTTTGGAAGTATGTGTTGCAGCATGTCAGGTCCACAAAAACCGTTCAGAAGATATGTGGAAACTTGAAATTACAAAAACTGATCCATGAGCAAGCAGCTCAGACAGACCGTGACAAACCAGATGATGGAGAAAGAGAAAACGTCAAAGAGAAACACACTCAGTTAACTAAAGAGCTTTTGGAAGTCAGAAGCAAAGTTCACCATCTTGAAAAAGAAATTAAAGCTTCACAGAAGGAGATTCTTGAAGCAGAGGAGACTTATTCTGAAGTTGGTCAACACATTTCTGATCTTGCCAAGAGAAATGCTTTGTTGAGTGCCCATTCCAAGCAGTGCAAGCTGTTAGCTGAGCTGTATATGGGTTTGGCTAAACAGATCAATGACAAGATAACAGTTTGCAGGGATGTTGCAAGAAAGAAATCAATTGACCCGACATATTACACCTCACAAGGAATCATTACCGGTAGCTCGCAGACATTCACTGCTATGGAAGGACGATCAACTCCTACTGGATTAGAGTCAGCTTGTACTAGATCTGTCAGGGAATCCTGTGAAAGGATTGGATCGTTTTTGCATGAAGTGTGCAAGGCAGATGAGGAAACTGGAAGGGTTGACGACAGTAGTCAGAGAAAGATTAAAGACGGGTTATGGACTGGAGTAGAGAATATCTTGTCTCAGCACCTAGCAAAGGATGTCCTCACCTCCTTGTCTCGAATAGCACAGGACTCTGCCGTCAGCCTGCGGGAATTGTCTGTAAGAATTGACCTGAAGAAGGACGCACAGGAACTCAAGTTTAAATATGAGAACTCAGGCAAACTAACAGACACATCATTACCACCTTCATTACTGCACAGTGTTCATCAGTTGATAGAGGAGAGTCAAGCTGCTCACTTTCAAAGGTTTATTGAGTCTGAAAAAGGGCTCAATGAAGCCTGGAGATCGAGGCAAAGACTTCAAACATTACAGCAACAACTGGAAGCCGATCTAGTCTCAAGTTATCAAGATTATCCTGGAAATATTGAATTGGCAAGAATTTTGCTTCACAATGAATGGAGCTTGACAGCATCAAAAGCATCGCTGAAATACATCAAGATGGCACTGGCTGAGCTGGCGAACTCCAGAAATGAGAGACAAAGAGCAAAGGAAATGCTGCTGATGAAACACAAGAAGATTGAAGACTTTGAAAAGCTGGCTCAAACCAAACAGTCCCTCATTCAAGCTCTTGTCAAACAAAATTCTAACGCCAGAGCAAGGGTTGAGAAACAAAAACATGAGCTCCTCCAGTACATACAGCAGAAGATTTGCTCGCATGAGGCTCATGTGGTTGCCATGGCAAAACAGCTTCATAACAGTGTCGCACAGGAGGTGGATAAGTTTGCTGCCCTGCCCTTGGATCAATTCCATTACTCAGGGGTAGACGGTGCAAGAAGAGTTCCAGTCAGTGAGTTATCGATCAATCGCTTAGAGAATCTGTCAACTAGTCCAGGAGGTGGTACAATAAGAACTGTGTTAGACAGTTTGGACTTCCCAACCTATAAGGCACCGGAAGAATTGCTGTCAACGACCATGAAGTTAAAGGAAAAAGTTGACGACACGAGATCCCTTGCACGATCACGTGATGTTGCAGTTTCTGAAGTGGATGGTGACAGGTCGTGCGAGAGAATGGTTGCGCATTTGAATGGCTTGAGACGAGAGGTTACTGAGCAAGATCGCGCACAACTTGATTACATTATGCCGCTGATACAGAACGGGCTCAATAAAACCACCAGAGCTTTGTCAGACTGCATTTCCGTTAAAGATATCGTGAGCTCATGGTGGGAGCAACCAGCTCAGTTTGTGACACCCTGGGTCAAGTTGGATGACATGAACATGCGACAATGGACAGATCAGTGGACACTGTCCGCTACTCGCCTGAGACAGTTGCAGATGAGTCACTGA

Transcript

OS493_017578-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9FMB4	AUGMIN subunit 5 OS=Arabidopsis thaliana OX=3702 GN=AUG5 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004610 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14817 all species →	HAUS5	HAUS augmin-like complex subunit 5	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029131 all species →	Family	HAUS augmin-like complex subunit 5	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR28588 all species →	HAUS AUGMIN-LIKE COMPLEX SUBUNIT 5	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0007098 all species →	Biological Process	centrosome cycle	Interproscan
GO:0051225 all species →	Biological Process	spindle assembly	Interproscan
GO:0070652 all species →	Cellular Component	HAUS complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16588	HAUS5, AUG5; HAUS augmin-like complex subunit 5	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017578-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

25.4Max TPM

6.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.94	14.21
polyp at pH7 6	18	18	9.65	15.72
coral polyp · control treatment	16	16	6.28	22.54
coral polyp · oil and dispersant treatment	16	16	4.50	25.43
coral polyp · oil treatment	16	16	5.22	10.13
coral polyp · dispersant treatment	16	16	3.69	10.66
Polyp	10	10	6.91	12.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.21
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.56
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.76
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.72
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.43
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.34
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.33
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.94
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.89
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.69
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.84
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.74
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.68
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.52
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.46
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.26
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.28
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.72
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.44
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.37
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.88
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.23
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.16
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.34
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.91
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.28
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.24
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.94
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.82
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.75
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.88
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.86
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.51
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.21
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.54
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.96
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.04
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.01
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.56
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.40
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.38
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.37
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.95
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.91
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.35
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.27
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.92
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.37
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.14
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.43
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.46
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.45
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.37
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.82
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.41
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.88
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.33
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.05
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.91
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.79
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.74
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.73
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.22
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.13
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.10
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.40
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.09
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.98
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.41
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.17
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.28
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.15
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.75
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.49
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.34
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.21
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.53
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.24
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.23
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.66
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.22
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.03
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.44
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.80
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.45
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.34
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.28
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.82
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.26
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.17
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.99
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.81
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.05
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.90
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.52
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.82
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.69
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.46
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.09
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.87
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.94
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.32
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.89
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.49

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.