Gene detail

Detailed information of OS493_017650-T1 in Lophelia pertusa

Genomic Location: scaffold_57:527806...537382
NR annotation: KAJ7379152.1, maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017650-T1

ATGGTAAAGAGAAAAGAAACAAATACGCATAGGTTTAAGGGATTTTCCGAACGTATTGCAGCTATTAAGATCGATGTGACGCACAAAATCCAAAGAAGTACTGAAACTCCAGAGGACGAAGATACATTCTTTTGTGAAGGTCTTGCCAAATGGACGGAGCTAAACTGCACTTTACACTTTCAGAACTTTGCTTCGGCTGTCAGGCAATACGTTCAAAGTCTTGCACAGCTTGTTCACCACAAACAGGAAGTCATAGAACTGCTGAAAGCGCATCTACAAATTCCTGGAAGTCTGGCGTTAGAGGCCTTGTTGGATCTCGTTGTTCAGTTAGCCAGGGATTTGCAGGCTGACTTCTATCCCCACTTCAGTAGTTTCTTCAATATATTTTTGTCTCTACTGAATCACTGTTGGCAAGATGCTCATATTCTGGAGTGTACATTTACGACCCTTAGTTATCTGTTTAAGTTTCTTTGGAGGTACATGGTGAAAGATATTCAAGATGTCTTCAGCCTGTACAGTCCACTTCTGATGGGTGAACAAAAGAACTACATTCAACAGTTTGCAGCGGAGAGTTTCTCCTTCCTTATGAGAAAAATCAAAGACTCCAGCAAACTCTTTGACATACTTTTCTCAACACTTGACACTCAACCAGGCTTATGTCAAGGGCTTGGATTTTTGTGTTTTGAAATGATCAAAGGAGTCAAACAGCAGTTCCATTCCATGACAGACTCTGTTCTGCCCATCTTGTTTTCTAAAACTGGAGATTTTCAAAGCAAGTCTGTTGGTGTGGCACATAGCTTACAATGGGAATTGGTTTACCAGACACTTGTTCACATGCTTGAGAGAGTGGCAAGATACACTGCAAAGGAACATTGTCAAGTGGTTGAAAAGTCTTTGGTTCAAGAACTGGAAAGGTTATGGAGTATTTGGAATGAAAAACAGTATGGTGGTGATCAAGAAGAATCCCTGAAGAGTCAGATAGCTTTTCTGCTAAGGTTGACCAATGTTTGGGTTTCCTGGAAGTCTGGTAGCCTGATCTGTGACCCAGTAAAGATAAATAAAGTTGTCCAGATAATGATGGTTAGTGATTTCATAACAGACATCATTGTCTCTCCATTGCTTGAACTCACATCAACGCTTCTGCAGGCATCATTCGCTGAACTTTCAAGAGATCGACACCAGAAACAACTGACATTGAAAGTCTTCAACACAGTGGACAATCGTGAACAGTTATTTTTATTCTGTAGACATCTTTTGAAGTGGGAGAACTTTCAGAAAGATGTGTTACCTTTCTTGTTGAACTGTTGCCAAGAAGAGCTTTTAAAAGGCTCATCAAAAATCCAAGAAGTCTTCGTTATCCTGACAGAGGTCATTGTTCACAACACTTCACTGAGTAGTGATGGCCTTGATTTGGGAAACTTGAAAGGCCTGCTGTTCTTTCCAAAATGTGGCACCAAACAAGGTGCAAAGATTTTAAGAGCATTCCTTGATAATGTAACAATAGATGGCAAGACGTTCTTAGATAAGGGCAGGCTTTCCTTGATATGGAGTATTCTTGTGTGCATTCCTTGTATAAGTCCTTTAGATATTCCTCAATGTTGCAGCCAGCTCCTAGGTTTTATCCATACCCTCACTGAATATCTTCAATCAAACAAGATTGCTGGAAATACTGTGGAATGCTTGAGTGTACTCAGTCAGGCGATTCAGTCATATGCTTTGATTGTGCCTAATGGAGAGGAAATCACTGAGCATTTAGACTTCAAGTTCATGCTGACATTAATCAGATCCTGGCCTGACAATGTTCACGTTCTCCAAGCTTGTCATAAACTGATGGCATCGGCAAGGAAACTTGGAATTAAAAGTTTTCTAGGCGGAGACAACCTTGAGGAGATGTACCCTTATCTTCGTCTCAATCTTTGCTCTGCTAGTCATGTTGTGCGTCTTCTTACACTCAAAATTTTGGCGTGTTTTGATCAGCCAGAAAATACTTCATTAGATAATAAGCCTCTTGCGTCGTTATTTAAGTTGTGTCTCGCAGCTGAAGAGGTTCCCACGCAGCTGGACACGTACAGAGACAGGCTGGTGTGTCTGCAGAAACTCCGCTTCTCTCCTGCGTTCTACGACGATCTACCAGATTTCTACAGGGATGCCGCTCTGCTCCATTTGTCTGGCATGCTTTGTGTGAACTTCAGCCCTCTGTGGGACCCCGTCATTGAGATTATCGCCAGTTTTGCTCAAAGCTCAAATGTAAAGCACTTTTGGGGAATCTTCAGTGAGCTCCTCGATACAGCAGCTGGGAAAACAGAGAACGAACTAGAAGAAAAAGTGAAGACAACCAACTGCCAACAACCAGCAATCAAAAATGGCGAACCAGTGGACAGTAGAGCGATCAAGTGTCTTGGTGAAATGTTTCAGAATCATAACAGTGCCTCGCTGGGTCCACGAGAAGAGAATAGAGCCGACCACGTGAACTTCCGCTATCTGTTATGGAAAGCAATGGCTTCCTTTCCGGAAGTTGCTGAGCAGAAATCACGTGATGTGGTACCACTGTTCCTAAGATTTGTTAGCAATGAATTTTTTGTGGCAATGGAAAACGTAGCTCCATCTCAAGACATACGAGCCAAACACATCTCTGATCCACATGGGACCCCGACAGATTTCAACCAATCAGAATCCACAGAAACTGAAGCGAATAACTCCACTTCCGAACCACAAGAAAACCTTCACAAAAGGAGACACAAAGCTGCTACGAAGTCCCTTTCTATTCATCTGAGCCTCTTCACAGCTTTCAAAAACCCCAAAGCGCTCTTCAAAGAACCAGAGATGAGACAGCTGTTTATGAGGTTCCTAGCTCACAGAGAGGCAGAAGTTCAAAGGCTTGCAGTAAAATGTCTCTTGACGTACAAGTTTGATTATCTGGAGCCGTACAAGGAGAATATTGAGCGCTTATTAGATGATGAGAACTTTCGGGATGAGTTGGCGCGTTTTTCAGTGGATGAGGATGACGGCATTGTGGTCAAGAGCCATCGAGACGGGCTAATGCCAGTCCTTATAAGGCTCCTGTACGGCAAAATGCAGAGGTGGACTGGGGCAGGTAGTGGTGGAAGAGCGGGCATCGGAGTGAGGCGAGCTGTAGTGCTGAGGTTCCTGGCCTCGTGTCCTCAGCAAGAGATACAAATCTTCATGGATCTGATTTTTGCGCCATTTAAACACCTGTGCACAGCGGACGATCCAGGCCTGATCGTTACCATGGCTACAGATCTCTCCAGTGTTGTCCCTCTGAAGAAACAGCAAGGGTTTCTGGAATGGTGTCGCAAATCCTGA

Transcript

OS493_017650-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O75691	Small subunit processome component 20 homolog OS=Homo sapiens OX=9606 GN=UTP20 PE=1 SV=3
Q5XG71	Small subunit processome component 20 homolog OS=Mus musculus OX=10090 GN=Utp20 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002640 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07539 all species →	UTP20_N	U3 small nucleolar RNA-associated protein 20, N-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR011430 all species →	Domain	U3 small nucleolar RNA-associated protein 20, N-terminal	Interproscan
IPR052575 all species →	Family	Small subunit processome component 20	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR17695 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0030686 all species →	Cellular Component	90S preribosome	Interproscan
GO:0032040 all species →	Cellular Component	small-subunit processome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_017650-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017650-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

8.3Max TPM

1.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	1.82	2.84
polyp at pH7 6	18	17	1.75	2.80
coral polyp · control treatment	16	16	2.61	7.27
coral polyp · oil and dispersant treatment	16	16	1.95	8.27
coral polyp · oil treatment	16	15	1.69	3.67
coral polyp · dispersant treatment	16	15	2.28	5.57
Polyp	10	9	0.69	1.33

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.81
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.40
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.33
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.28
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.00
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.84
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.76
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.68
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.42
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.35
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.26
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.16
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.10
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.73
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.55
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.61
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.60
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.43
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.10
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.08
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.94
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.90
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.89
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.65
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.61
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.48
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.37
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.25
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.21
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.87
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.81
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.72
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.07
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.87
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.74
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.74
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.46
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.08
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.67
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.28
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.97
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.90
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.38
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.32
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.27
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.54
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.47
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.30
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.28
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.18
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.86
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.70
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.53
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.35
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.25
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.21
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.97
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.75
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.46
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.12
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.67
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.11
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.58
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.53
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.26
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.25
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.88
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.71
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.65
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.63
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.93
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.90
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.77
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.67
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.57
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.54
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.42
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.16
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.05
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.74
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.15
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.81
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.80
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.67
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.54
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.52
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.42
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.58
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.50
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.33
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.02
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.84
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.65
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.60
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.45
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.45
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.