Gene detail

Detailed information of OS493_017651-T1 in Lophelia pertusa

Genomic Location: scaffold_57:537388...560645
NR annotation: KAJ7379153.1, maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017651-T1

ATGGGAAGCCTTGCGGTATCTTTTCTTCCTTCCATCCTACAAATCATCCTGTCATTACTGTCAACGTGCGTGTTTGCTCTGGAACACCGGGAAAAGGTTCACCAATCGTTGATCTCTCAGCTGAAGACAGTTCGACAGTTGGCCATTTCTCGCTTGACAGAGTTCTTTGAGTTCATGACTGATTATGACTTCAGACCCATTTGTGATGCCGTGTTCTCGTCAGCCGTGTGGCCTCAGATAGAGAAGCTGAACCAAGAGAGCATTCAGCATCCAACGCCATTGCTCAAACTATTGTTCGCTTGGTCTAAGAATTCCCGTTTCTTTCCCTTGCTGTCAAGAAAACCAGCTGAAAACCCCGACCTGTCAGTCATGTCCTGTGTGTTTGCCTGTCTGGGCGTTCTATCAGTGTCAGCGGATGTAGTTGCCATGGTAATGGAGATGACAGACAATCTTCTAGCCACAAGTCAATCAGAGATGGGAGATGAAGAAAGTGATTTATTGGAATGTGGCTCAGAACTGAAAATACCCTCGAATTACGACCATGAAAACAGGCCCAGCTACGGAACATTGTTAGTTCTCCCGCACATAACACAGATCTTGGAATATCTGAGTCGTTCAGTCAAACAAGCTATCGACAACTCCAGAGGAAAGAATAAGGGAAAAGTGATTCTTCCTCAACGAGAGCTTTCAGTCTTGTCTAAAATCAGCCCATTTGTGAAAGACGCTAAACAATCTGCCACATTAATAGACGTGCTACTGCCTTTTATGGGTTCTTCTCAAAAAGAAGAAACAGCGAACAACATGCTGAAGACCGTTAAAAGTTTACTAGCCAAAGTGGATACACCGAGAGACTTCGTTACACCTTTATCGAAGCTCTTCTCGCAGATTAACACCCGCAGTACACGGCAGTGCCTGTGTGACGTGTTTCTTGAGCTGGCAAATGTCGATTCAAACTTCTCTTCGGAGACGTGCGAGATTCTTGCTCGCGTAAACTCGTGGAACGCTAAGCGCCTTGAAGAGCCTGATTATGATACAAGACTCGCCAGCTTTGCGAATGCCAAGCTTCTTGTCCAACAAGACGCACTGAAAACAGAGGAAATTCTACCATTGCTACACAACTGTATTTATTTCGTTTTAAGTAGCGATGATTTGTCCATCAGAGACAGTGCTGGCAGCTGTATGAGTTGCATCGTGCGTTACGTTGTACAGCGGAGTGGAGTAAAGGATGAGGGATTTCATGTTCTAATCATGAAGTGTATCCTACCAGCTTGCAAAAAGGCTCTCGCTTCCAAGAAGGAGCTTGCCAGGAATGAATTTCTAGCCGTGCTTTCAACGATGGTTCGTCAGTTTGAACACGATTCTTTCTCAGATCTGAAGGTTCTCTTGGATGATGACCACGAGAAAGACTTCTTTGAAAACATCAAACACATTCAGCTTCATCGTCGCATTCGCGCACTTCGCCGCCTGCAGTCACATTGTCAGCAGCACAGCCTCAGAACCACAACCCTGACAGCCTTCCTGTTGCCATTGGTAACACACTGTGTGTTTGATCACACGGCTGCTAAGGAGCACAATCTTGTCACCGAGGCTGTCACCACAATAGGAACAATATCGGCCAGCCTGCCTTGGTCCAAGTACTGCTCTCTGTTAAGACACTATTTGAAACTGTTAACTGTTGAAAAACATTCCCAGAAAGTTATCATCAGGATTGTGGTAATCATTCTGAACAATTTCCACTTTGACCTCAGTACTGTTCCTAAGCAGATGGAAAGAATTAAACTCAACGAAAGCAATGTAGCCACTGGAAACACAAAAACAAATAATAAAGTTGAGAATAAAACTACAAGTATTGAAGATCCAATCAAAACACAGAGCGAACCTGATAAAGGTGATGTTGATGATGAGGACGACGATGATAGTGCAGAGGCAGATGCAGTTGTCAAGGAAGAAGCAACGGATCTTACCAAAGAAGAACTTGCTTTGCGTATTTACAACACAATCACCTCAACTATTCTACCGCAGCTACACAAGTGTGTGACTAAAAAGAGCAAGTCGGCAGATTTTCACCGGCTGAGCCAACAGAAAGCTGAAGATGAAGAGGACATGTTACGTGTTCCCGTCATTCTCGCCATCATTAAACTCCTGCAAGCTTTACCCGAGCATGCGCTCCACGTACATCTACCAGGTCTTCTTCTGCGGATCGGCCACACATTACGCAGCAGAGCACGAGAGGTCCGTGATACAGCGCGGGATACGCTTGCAAAGATCACCGTATCCCTTGGAACCCGGTACTTCTCGTTCGTACTGAAGGAGCTCAGAAGTTCGTTGACAAGAGGATACCAGCTTCACGTCCTTAGTTTCACCATTCACACGTTATTGGACAAAATGAGCGATGGCCTGGTACCGGGGGAACTGGACCCGTGTCTACAGGGATTAGTACAGGTGCTTGTTGAAGACTTATTTGGTGAAGTTGCAAAAGAACGAGAGGTGGATAAGATTGCTAATAAGCTTCCTGAAGCCAAAACATGCAAAAGCTATGATACTTTTGAGATCCTCGCCAAATTTGCGGGAACAAGGTCGTTGACTGCTCTGGTTTCTCCTTTGAAAGAGGTTCTTGAGTCGACGCAAAGTCACAAAACTGCTCGTCGCGTAGAAGAGGTTCTGCGAAGGATTGGAGCAGGACTGCAGGCGAACACAAGCATCACTCCACAGATACAGCTCATGTTTATCCACGGACTTACTCGTGAAAATGTGCCGCTTTTGAAATCAAAACCAAAAGAAAAGAAAGAAACTCCAGTACAAACAGACCCCAGACTCCACCCTGGAAGCTCGTTATTACTGCCACCCGCCCCCACACGGGGAGGAAATGTCCCTGTGACAAACACCAAGACAAATCATCACATCCTGGTCGAATTTGGTATTCAGTTGCTGTACATGATGCTAAAACACGGCAAAATCTCCTCGTCAGACCAGGAACATCAGCAAATGTTGGATCCTTTTGTTGGCTTACTTACCAACTGTCTCAAATCCAAATATAACAAGGTTGTGACGATCTCTCTCCGTTGTGTTAGCTGGTTGGTTAAGTTCCCGCTGCCTTCGTTAACTCGCTGTGTTCCCGTAATGGGAAAACTGCTCTTCAACTTACTCAAGAATTACGCAAAAGCCGGTGCAAAAGTTGGAGAGAACTTCGAAATGGTTCTCTCTGCCTTTAAGGCCATGACGGTGATCATACGGGACTTCAAACAATACACTGTTGCCGAGAAACATCTGCAGGTGTTGTTAGGGTTTGTGGAGGAAGACATCCATGATCACACTAAACAGGGAACAGCATTTCCTCTTCTTAAGGCGATCCTTTCTAGGAAACTCATAGTGCCTGAAATCCATGACGTCATGTTGAAGGTGGGCCAGCTGTCAATCACCGGCAGTTCACCGTCGGTTCAGCTTCAGTGCAGACAGTGTATGCTACAGTTCCTTCTTGACTATCCACTGGGGACTAAGCTACAAAGATATCTGGAGTTTTATGTTTCCCAGTTAGACTATGAACATGAGACAGGCCGAGAATCAGCGCTGGAAATGTTAGCATCCATGTTTTCTTCATTCCCCGAGTCCATGCTGTTTAGTTACGCTGGTTTCTTCTTTGTACCGCTGACCTCTCGCTTGGTGAATGATGACTCAGCCGGTTGCCGTAAGCTGACAGCTCTGGCTATCAAGTCACTTCTTGACAAACTTGATGCCGATCAGAGACACAAGCTATTTTCCATCGTGCTGTTATGGTTCAAAGATGACAAGATCACTCTCCAGCGTCTTGCTGCTCAAGTCAGTGGTTTGTTCGTTGAAGTTGAAGGGAAGAACTTTGAAAAAAGACTTGGCACCGTATTACCGCTAATTGCCAGCCTCATTGCTCCAGACCAGTTTGAAATGGAGGAACCTGCGGAGGGAGATGACGAAGAGCTTAACAGCTTGGAGGGCCTTCATCGAATCAAGGATCACCTTCTTTTTAACACTCTGTCATTACTGGCCAAGGTGATTAAACAGTGCCAAGTTATCAAGAATCCAAGCCGACAACACGATATGGCGCAAATCTGGGAATCTGTGGAATCACACTTACTCCATCCGCACGCCTGGGTACGACTCGCGTCCAGTCGATTACTCGGTCTGCTTTTTGCCGCATGGAAACCCGACGAATTGGTAACTAGTTATCACAAGGGAGCTACGTCAATCGATTTTCTGTCGGAAGATTTACCTGCAAAGGTAGCAAAGCTTTGCGACGACTTTTGCACTCAGCTTCGTTCGCCTCTTTTGGGAAACGAATTGGGAGAACAGATTGTGAAGAACTTGGTATTCCTGGCCAAAGCACTGCAGATCCTAGATGGCGAAAACGAATCGACGCTTGAAAATGGACAAGACAAGCAAGTTGCTCTTGAAGAAGGTAACAACACTGAGGATGGAATACCTTTCACGCTGACAGCTCTCCTAAGCCGCATGAACAAGTTAGCAAAACTAGAAGCTTCTCAAACTCCTAAACATACTCAAAAGAGATCCTGTGTGTTACGATGGTTGGCTGCAGTGTCCATTAATCTTGGAAAAGATGGCATTGAACCGCACCTTGCTGACATTCTGAGCCCAGTTTACAGGGAGCTGGAACTAGCCACGACATACAAAGATTCCGATTTGATGAAACTTGCCCAGGAAGTGCTGGAGCTCATCAAAAGTCTTGTCGGACGAGAAACGTTCTCTCGTGCGTACGCCAGCCTCCAGCAAACAGCGACTGAAGCGCGGGAAACGAGAAAGAGAAAGGCGGCGTTGGAGGCGGTGGCCGATCCAGCGAAAACTGCTCGAAAGAAACTTAAAAAGAACTTGGCGAAGAGGGAAACAAGGAAAAGGAAGATCGATTCACTGAAGCCGGAGAGGAAATTAAAGGCATCTAGAATGTAA

Transcript

OS493_017651-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O75691	Small subunit processome component 20 homolog OS=Homo sapiens OX=9606 GN=UTP20 PE=1 SV=3
Q5XG71	Small subunit processome component 20 homolog OS=Mus musculus OX=10090 GN=Utp20 PE=1 SV=2
O60055	U3 small nucleolar RNA-associated protein 20 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=utp20 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002643 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20416 all species →	UTP20_C	U3 small nucleolar RNA-associated protein 20, C-terminal	Domain	Interproscan
PF07539 all species →	UTP20_N	U3 small nucleolar RNA-associated protein 20, N-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR052575 all species →	Family	Small subunit processome component 20	Interproscan
IPR046523 all species →	Domain	U3 small nucleolar RNA-associated protein 20, C-terminal	Interproscan
IPR011430 all species →	Domain	U3 small nucleolar RNA-associated protein 20, N-terminal	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR17695 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0030686 all species →	Cellular Component	90S preribosome	Interproscan
GO:0032040 all species →	Cellular Component	small-subunit processome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14772	UTP20; U3 small nucleolar RNA-associated protein 20	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017651-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

16.5Max TPM

7.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.11	12.44
polyp at pH7 6	18	18	9.01	13.04
coral polyp · control treatment	16	16	7.92	16.45
coral polyp · oil and dispersant treatment	16	16	5.02	11.66
coral polyp · oil treatment	16	16	6.51	10.14
coral polyp · dispersant treatment	16	16	5.71	13.13
Polyp	10	10	8.52	14.01

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.44
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.01
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.59
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.91
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.66
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.95
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.81
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.77
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.73
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.70
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.60
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.59
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.53
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.41
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.13
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.68
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.57
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.04
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.81
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.12
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.89
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.76
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.37
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.35
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.90
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.60
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.26
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.91
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.44
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.33
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.80
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.19
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.14
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.45
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.58
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.30
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.06
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.73
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.89
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.27
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.98
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.97
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.24
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.68
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.56
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.70
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.64
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.31
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.32
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.66
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.17
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.74
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.26
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.01
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.27
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.89
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.46
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.38
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.08
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.51
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.44
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.22
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.46
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.37
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.14
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.43
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.18
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.62
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.25
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.73
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.87
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.82
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.67
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.60
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.59
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.55
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.52
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.08
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.03
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.14
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.13
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.56
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.25
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.25
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.05
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.48
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.86
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.27
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.31
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.15
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.75
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.29
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.03
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.65
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.54
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.01
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	10.99
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	10.57
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.95
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.78
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.15
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.24
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.17
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.77
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.52

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.