Gene detail

Detailed information of OS493_017777-T1 in Lophelia pertusa

Genomic Location: scaffold_57:1754791...1776055
NR annotation: KAJ7379264.1, toll-like receptor 7 signaling pathway [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_017777-T1

ATGAATGACATTGCACAACAGAACGTCAATAATTTAGTAGTGAAAAAGGACAGGGCAATGCGTTCTCAAGAACCTGAGAATGATGAAGCCCACTCAAGTGATCCTTTGGCTATTAAGGCAATAATTCCAGAAAAAGTCCAGCGTGATGTAACTGGTGCAGTCCAAGTCTCTGCCAAGCCGTTGAACAGTTCTACCTTAATATTGGAGACACCAGAGTATGCCAAGGCAAGTGTTGTGACAGCATATGTCTACCATGGCGTTCATCGACGTTTGTTAGGCCAGCACAGCTTTGAATTTCTTTCAAGGAATGACACGTTTTACAGACTGCTGTATGGAGCACTAGGCCCTGTCAAATTCATGTGTGAATCTCTGCAGCTCACACCAGCTGAAGTCCACAGTCTAGATTCTGCTTTGGCAGAGACATTTAGAACAAATGCTCCTGAAGGGTTCAATTTGCTTGGCATTCATAAACATGTAGCAGCAGGTGGAGAATTAGAATCCAGTGCAGAGCATCCGACTTTGCTTCACTTTGCATCAGAGTTTGGATTAAGCAGGCTAATCAACAACCTTTTGCATTATCCTGGAGCTCAAGAAGCTTGCTCGATAAAGAACTATCATGATCAGCGGCCATATAACATAGCAGACAATCACGGTTTCCATGACTTGGCAAACATTCTACGTACTTTTCGTGACCAAGGAGATCCAGAGATTTACATTGACATGGAGCATGATGAAAGTGAAGATTGTTATTACGTCAAAATGAAAAAGGATGACGGTTCTTACTATTACACCCCAATGAATGTAAACAAGAAGGGAAAGAGATACATTAACCTTAATAAACCTGAAGATGAATATGAAGATGAAGATGACCATTACATGAAAATGCAGAAGGAAGATGGTTCTTACTTTTATGTACACAAGAAAGGTGAAGCAGCAGCCCAAGGTGGTAAGATATATGATGTATGTAAGGAGAGGTCAAGACAATATCCCACAGTTCAAGAGCACCCTGAATCTGATCAGTGCCCATTAGAGGATTTATATGAAAACTGTGCTACACCTGCTACTGATCATGATGGTGAGTTGTATGAAGAAATGGAAAGAAATCCTGAAGAACTGTACATGGACATGGATCTGGAGAAAGAAGACCCATCAGCATTATACGCAGAAATGGAATCAGGGCAAATGTCAGACAAATATGCGCATTATGATAGACCAAAATCAAACTTGCCAGTTAATCCTGATCCAGCCTTTTACCGCTCTGCCAGTAGTGCTGCTGATATCATTAGAGCCAAGCAAATTGAAAATCAGAGAAAAACCCAGTCCTTACCACCACCACGAGGTGGAATGTCTCAGGTAGATGACCTACGAAATAAGTTAGTCGACATGTTAGGGCAAAGTGCAGTAAAAGGAAGTTTAACAAATGAGGCAGTTGCTGACTTATTGAAGAGCATGCAGGGGATCCCAGAATCTGCGCCGACACTTCCAAGAAGAGGATCAACAAGTTCAAGAAGCTCCACTTCAACTACAGGCAGTTATGGTAGTACTGGTAGCAGTGGAGTACAGTCAGGACATGAGTTCACACAGCATCAAGAACCTACTGAAGATATTGACCATGAAGATGAAAACATACATGCTACTCTTAAAGATCTCTTTCCAAATATTAAACAAAAGATTCGTAATGATGACACCCAAGCTCAGATGGAACCCAAAGATGCTCCCCCTCCACTCCCTCAACCAGACTATGAGCGAAAGGAGATTACAGGAAACCCTGGTACAAAAAAGCATCATTCAAGGCATCATCTAACAACACCTGTGAAAACAACAGATTTACCTGCACAACCACCGCCAGTAGCTCGACGCAGAAGTGAACCTCTTGCTACAGCAGGTTTAGATATCCAGTCAAAGACACCATCTAAGAAATATCAGCCACAGTATGCTGAGAGGCTCCCTGCCCCTATTCCAGAGAGTGAATCATCAAGCCTCAAAAAAGCCCACCTCCCACTGCTTCACGGAGATCTATGCCTTTCCCTGATAGCTCAAGACCCCCTGCCCCTCTTCCAGATGTACAGAGGCAACAAACTATGGGTCCATCTCCAGTCAGGAGACAACCTGGTGGTGTACCAGTCTTTCCTGAAGAACCACCTCCTCAACTCCCTCAAAGAGGACCAAGGCCTATGCCACGTGGCAACCCAAAATGAACATCTAAACTAA

Transcript

OS493_017777-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002595 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14545 all species →	DBB	Dof, BCAP, and BANK (DBB) motif,	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017893 all species →	Domain	DBB domain	Interproscan
IPR052446 all species →	Family	B-cell PI3K Activation and Signaling Adapters	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16267 all species →	BANK1/PIK3AP1 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005102 all species →	Molecular Function	signaling receptor binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_017777-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_017777-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

105.9Max TPM

34.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	32.47	48.92
polyp at pH7 6	18	18	27.79	42.72
coral polyp · control treatment	16	16	48.43	105.85
coral polyp · oil and dispersant treatment	16	16	32.44	56.89
coral polyp · oil treatment	16	16	35.59	82.95
coral polyp · dispersant treatment	16	16	40.03	79.71
Polyp	10	10	19.27	33.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.92
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.38
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.15
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.95
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.75
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.69
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.01
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.44
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.35
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.68
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.90
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.33
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.28
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.63
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.58
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.26
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.20
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.79
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.20
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.19
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.62
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.56
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.44
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.02
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.15
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.65
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.84
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.04
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.02
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.55
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.03
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.42
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	105.85
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.25
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.86
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.82
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.72
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.99
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.95
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.02
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.81
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.38
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.29
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.03
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.11
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.24
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.15
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.89
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.55
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.67
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.10
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.70
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.91
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.74
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.66
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.82
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.13
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.95
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.73
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.82
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.49
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.57
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	82.95
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	80.17
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.15
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.02
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.51
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.62
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.01
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.40
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.91
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.36
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.81
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.13
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.32
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.27
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.94
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	79.71
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.66
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.50
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.24
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.68
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.03
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.83
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.76
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.37
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.76
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.54
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.76
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.16
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.16
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.79
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	33.48
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	32.03
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	28.36
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	22.95
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	17.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	15.89
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.58
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.98
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.32
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.82

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.