Gene detail

Detailed information of OS493_018142-T1 in Lophelia pertusa

Genomic Location: scaffold_59:1307481...1351712
NR annotation: KAJ7360154.1, hypothetical protein OS493_018142 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018142-T1

ATGGATGCAGGGCAGTCGTTCTGGTGTTATGGATCCCAAGCAGGGTGCATACCTCCTGGAACACTGAAGAAGGTCAAAATAGATGGTGTACCAGGCTTGGCTGTTACTCTGTTTAGTTTGTTGCTTGACTTGCACAAAGATGAAGAGATTGCAAGAAAATCATTGGATGAACAGTTTTATACTTCACTTAGGGACAAGGTCCTTGGACTTCCGTGGCATGTGAAAGGAAGATATGGCTTGATCTGTTTACTTCTGTCTTATGTTGGGCTTCGACAGATCCTAGAAAAGCAACCTACTCTGTTAGATGACTTGATTCGCTGCCTGGGAGTCAATCAACTAACATCTCCTTCCACAAATGCTTTCAAGGCTTTTCTTGAATGGGGAAGAAAGGATCAAGCTAAGGTGGAGCTGAAGAAACAGGAACAAACTGAGTTCACTAAACAGTGGGAGAAAAGTTGGCAAGCTGCATTATTTAGGGCTATAACAAGCAAAGATAGGTCACTGCAGAAGAATGCATGTCTATATTGGCTGCCATGTGTACTCAAGTGCATTCCTGAATCTCTTGGCTCTTTACTTAAAGAACTGAGAGATGCATATGACAAAGAAGGAACAGCAAGGAATACTACAGAAAGGACAAGGGCTTTCTCAGCTTATCTTGCAGTTTTAAAAGTCAGTCGTTCCTTGGCTCTTTTGCAAACTGAGGACTTGGATGAAATCCCTCTGCATCAGGGTCTCACTCATCTACATGATGACATCAGAGCTACTGCATTGTCAGTGATTAGTTTAACACCCAAGACTGCAGAACCTTTGTCAGCAGTGGAACAAAAGCTTCTGAGGAAATTCCTTCCTCATAACTTAAACACAGCTTGTGCTCCATTCAGGCAAACACTTTTTGTGTCTATGAAGAAAATACTTGGCAGGGTTAGAGACAGTAGCTTGATCCTGTTGAAGGAACACTGTCAACTTCATACGGTCCAAGGAAAAGAGGACTGTGTTCTACCTCGCACACTTAACACAATGTTTGAGTTTGTGACATGGTTATTTGATCTGGCAGTGGCATGCTTCTTTCCAGGAGCCTCCTACCAAAGACAGAAGACCGTAAAATGGCAGCCAGACAAGAAAAAGGGTCAGCCACCAGCTTTGTGTCACTTGCTTGTTTCTTTGGCCAATAAACATGGATACTTTGAGTTTTTCTCCACCAGGAGTGCTGTCATCATGTTTGGATGTATCGAGAGTCCATATGCTGATATTCGTGATACAGCAGTCTACCTTCTCCAAGAACACTTTTCATGGCCTGTTATATTGCTTGGGAATGATTCCACAGCATCTGCCAGCTTGTTGATACACAAGGCCTTGACTCTAGCGAGAAGCCCAAAAGTACAGGACTGTGAAAGTGCAGCTGCTCTATTTCAGCTAATCCACAGCAAAGTTGGGATGGCAATTCAACTTCTCGTCAGGGGATGTAAAACCCCAGCAATCCTTGACAGTAAATCACATGGAAAGCTGTGTAGTGCTGTACAAATGCTACAGCAGCTTTTGGCTGAGCTCAAGATACATGTGAAGGCCGCACAGGATATGACGCTTGCATCACAAAATACACCAGGCCATGGCATTTCACTTGCCATGGCGCAGTGTGTTGAAGTGACATACCTTGACATCAACAAAGTCGAGGAGGATCTAGACTGTTGGCGTCATCTCCAGACTGTACTCCAAGACACTGTAGATACAGCTGTTCATATCATTACCTTCATGTTGGACATGCTTTGTGGAAAACAAAGCACTGATACAAATATAGGTGAAGCGTTAGATGAAATATCATCTTTGTCAATCAATGAAGTGGAAACAAAAGAACCCTTTTCTGTCCAGTCACACAAAGACGTTGTTATTTCATGCTGCTGGCTTCATATCAAGTATGCATGTCATCTTCTGGCAGTTATTTTTGAAAAGACCACCATTCAACTTGGATACACTTCCATGCCCACATTACTTGATGAAGAAACTCTCACGCGTATTGCGGAGACAGCATGGAAAGTTATCATACAGTGCCGGCACCAGGGTGTTGTCCAACATTGTCGGGTCAGTTTCATGAAGATTTGCCAGTGTCTATTCCATGCATCACAGCTGTGTCTTCACTCTTTGCCAAACAGATGGTTAGATGACATGTTGAACACAGTGTCCTCATCAAGCTCTGTAACTTCTGTCACCAGACGCAGTGCTGGACTGCCAGTGGTGTTTTGTTGTATTCTGTCATGTGAACCAACATCTGGTCAAAGACCTCTGTTAAAACATTGTATGAAATCTCTTCTGGACACCGCAGCATCACCACTTCCCATTGTTATCGACCAACATAAAGATCTCCCTCAGGTACATGCAATCAACATTCTGAAGGCACTCTATCAAGACACCTCGCTTGGTTGTGAAGTGTTGCAGTATGCCTCACAGGGAACCGTAATGGCTGTCAGTGGTTTTGCATCTTCGTCATGGGCAGTTAGAAATGCTTCCATGCAACTGTTTGGTTCCTTGGTAAAGCGAATGCTTGGTCAGCGGCGAGGAACAGATGACGACAGTGAAATGAACACAATCAGTGCCATGGACTTTTTTAACAGCTACCCTGCTTTACACAAGTTCTTTCTCACTCATTTACAAAACACATCAGATTCTGCTTCAAAGTCTTCATTGTTTTCACAAATGTCAAAACCTGAACTCTTTCCTATTTTGACACTTCTATCAAAGCTTCACCCATGTCCTGAAGCCAGTACAAGTTCATCAAGCCATTTGTCAGACTTTGTTCCTCATATCGTGTCACTATCATCATGCCCAACCTATACAGTACGTGTTGTTGCAGCAAACGCTCTTGTGCCATTCATCCCAGATGACCATTTGTTAGAAAAGGCAAAGGAACTGATCTTGCTCCTCCCAGGGCCAGTGCAGCGACTTTCACAGAACGTTCTTCATGGGACATTACTCCAAATTCGTTCTCTCCTGGGAGCTGTTAAGTGGTCTACAGTAAGCAAGGATGGTCGTGGTGTTCTAAATGAAATGCTGAACAAGATTTGGATATGTTCCTGCAGTAATGGTTGCCCTTTAACACGAGCTTCCTTCCTCGATATTGTCATGAGGTTTGGGCCTGTACTCGGGCAAGACTGGGAATGCGAGGCATCATACAATGGAGCTAATCATCCACTGCTTGATGATGCACAGTGGGAGCGTGCACTGGTGAGAGCGTCTCTGGAGCTTGAGTTTTATCACTCGTGGACAGAAGATACTAAAACCAAAGAACAGAAAACCCTGTTATCCCGTCTGCTTGCATCAACAGACAAGGAAAAAAGATTAGCTACTTTAGAGTATTTGTCCAAGGAATTACACCAAAGAGATAGGTCTCTACTACCGAACTCAATCCAAGTTGATCTGGCTAATCTTTTAATTACGGAGTCAGATCATGTTTGTCTTGTCGTAGCACTGGAAATGTTTGTGGAAGTCTGTGCTGGTTAG

Transcript

OS493_018142-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A8C756	tRNA (32-2'-O)-methyltransferase regulator THADA OS=Mus musculus OX=10090 GN=Thada PE=1 SV=1
A8C752	tRNA (32-2'-O)-methyltransferase regulator THADA OS=Chlorocebus aethiops OX=9534 GN=THADA PE=2 SV=1
A8C750	tRNA (32-2'-O)-methyltransferase regulator THADA OS=Canis lupus familiaris OX=9615 GN=THADA PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001290 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10350 all species →	DUF2428	THADA/TRM732, DUF2428	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR051954 all species →	Family	tRNA (32-2'-O)-methyltransferase regulator THADA	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR019442 all species →	Domain	THADA/TRM732, DUF2428	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14387 all species →	THADA/DEATH RECEPTOR INTERACTING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0030488 all species →	Biological Process	tRNA methylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_018142-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018142-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

214.4Max TPM

28.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	56.17	214.35
polyp at pH7 6	18	18	58.58	200.13
coral polyp · control treatment	16	16	17.11	50.06
coral polyp · oil and dispersant treatment	16	16	13.35	28.04
coral polyp · oil treatment	16	16	17.71	40.12
coral polyp · dispersant treatment	16	16	12.35	35.85
Polyp	10	10	12.22	19.68

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	214.35
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	212.28
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	104.48
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.14
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	101.65
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	101.53
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.11
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.73
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.86
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.21
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.73
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.82
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.40
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.04
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.85
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.37
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.29
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	200.13
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	198.24
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	167.87
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	167.72
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	100.44
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	98.79
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.94
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.78
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.50
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.21
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.71
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.60
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.16
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.48
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.46
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.26
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.99
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.14
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.06
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.71
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.20
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.82
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.94
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.76
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.76
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.97
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.97
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.87
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.71
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.92
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.79
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.41
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.60
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.32
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.04
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.63
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.50
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.13
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.99
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.36
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.64
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.63
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.66
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.77
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.74
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.05
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.60
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.59
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.12
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.90
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.84
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.42
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.91
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.57
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.47
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.04
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.82
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.30
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.28
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.15
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.44
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.43
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.04
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.56
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.85
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.95
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.71
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.65
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.54
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.50
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.54
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.40
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.23
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.33
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.88
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.98
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	19.68
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.27
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	15.14
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.80
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.16
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.59
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.99
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.76

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.