Gene detail

Detailed information of OS493_018245-T1 in Lophelia pertusa

Genomic Location: scaffold_60:594552...611339
NR annotation: KAJ7333075.1, Dixin [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018245-T1

ATGTACAATTTCCCAAACGAAGCTGGTAGACCAATTCCCGTTGCTTCGTCCAATACTCCACGAAGCAAGCTTAGTAGGAAAGAAAGCGGTGGTTACCATGCCGAAAGCTGGTCGACATCTTCGCCGTTGACAAGAGAAACGCTCAAGCGAAACACTGAAGAAGGAAGCAAACGAGAGGAGCAATACGTTGCGTGGGTGAATTCACAACTCAAGAAAAGACCCGCTAGTCGTTTTGTCCGCGAGATCCCTAGGGATACAAGAGATGGCGTTGCTCTGGTCCAGCTTGTGGAAGTGTTGGCTGGTGAAACTCTGAAATTCGATGAATCTCCAACAACCTACGCATCCAAGAAGGAGAATGTGGATCATGTTCTACATTTCATGGCCTCCCAGAGAATTAAAATGAGACAGATACACTCGAAAGACATTGTGGATGGCAACTTAAAAGCCACAATGCGACTTGTGCTCGCACTAGCAGCTCACTTCAAACCTGGAAGTGTGAAACCACCGGCACATCAGAGTGGCTTGTCGCCCGCGCAGACTAAGCTCGCACGAAGTCCATCAGCTGCGGCAGCTGCTGCCGAGGCTGCTGCTGCTATTGGCGAGGCTAGCAGGAAGCTAGCAGGAAGTGCTGGGAGACACATTCATATGCCCTTCAGGCTTAGGAAAACATCTAAGCCAACTCCTATTACTCCAAAGATAGATCGTCACCCAGTGGATGTCAGTCCAGGCACCAGCCCCACGCTGTCTGCATCGCCGCTCAACACGCCGTTAAATAGAACACCCGTGAGGAAGATAAGTCGGCCGTCCAGTGCTGAGTTTAGACACGACAAGGACAATGGGTCTGATGGTTCTACCGTTAGCAGTGGAGGTACCACTCCCAAGCTGTCACACAGAGATTTAGAAACTCTTTACTCTGTGTCCGACGATTCCGAGTCTGTTTCCTCTAAAGATCCCGGAAAGAATAACAACACCAGTGCATTTCCAAATTTAGAGTTTCTTCGTGAAGTATCTGAAGGGTATGACAGTATGGAAGAGGACACAAGCAGTACCAAGGAAATGCTTCTACATCTACAGAGCTTGTTACTGAATGGCAGATTAGAGGAGGACGAGATCCCTGAAGAGTACTGTGGTCTTGAAGGTTCAACCGTCCAGGAACAACTGACAATAGTGAGCAGTCGGCTTAATCAGAGAGAAGTTGAGTACGACAATCTGAAAACAGAGCTTAACAAGACCAAAGAGGAGTGTATTAATCTACAAGGCACCAAGGCTGGTCTGTTGTCCAGACTCAATCATCAAGAACAGACTATAATGCAGCTTCAGTCAGACACGTTAAAACACGAGTTGTCACAGCAAAAGTACGAATCAGAAGTAGGACAGTTACAATATCAACTTGCCGAGAGGGATAAGGAGGTGTCGGCCCTCCGAAATGAACTGGTGCGCAGGGAGAAAACAGCGGATAAACAGCGGCTGGAGCTTGAAGATGCCGTGAGGCATATTGAAGGACTTCAATTTGCACAGGCAGGGCCTGGCAGACAAGTAGATGACGGCATTGTTATTGAATTGCAACAGAGAATAAGAGATCTACAGGAGAAGCTTGATTCTGTTGGAATATACGAGGCAACACTATCAGCTCAAATTGCCACACAAGATGAGAAGATGGCGTCACTAGAGGACAAGATTTTAAATCCACAGATTCTACAGAACAGCTCTGCTGTTGTTTCTCATGGACTGAAGAGGTCAGAAGAAATGGAGGTGGTACGTGAAGCTGTTGAAAGTCTACGCAGCTGTTTTAGACCACATGATCCGCATCATCACACGTTGGATACGTTAGAACAGAGTATTGTAGCAGTCCACTCGTCTTCAGACCAACATTCCCACGCCACAGATTCTGATGTTGAAAGTGTCCATATAAAGGGAGTGAATGGATTTGAACATAGCAATGGGTACAATGGTAAATCAACCCCGCATCAAAGACAATTAGAAGGTAATGCAAGAGAAACATCACGAATCAGCACCAAAGTGCTTTATTTTACAGAGAAGACAGTCACGCCCTTTCTTACATCAATTCCGAGAAGATTAGGAGAAATAACTTTAGGAGACTTCAAGGAAGCAATCGACAGACCCGGAATATTTCGTTATCACTTCAAAGCGTTGGATCCTGAGTTTGGAACAGTTAAAGAAGAGGTGATTGACGATGGCGATATAGTGCCAGGTTGGGAAGGGAAGATTGTAGCTTGGGTAGAAGAGGATTCAGGACAAAAAGCTACCTCCTATCAAGAACAAATGGCGTGA

Transcript

OS493_018245-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q155Q3	Dixin OS=Homo sapiens OX=9606 GN=DIXDC1 PE=1 SV=2
Q80Y83	Dixin OS=Mus musculus OX=10090 GN=Dixdc1 PE=1 SV=1
Q2VUH7	Dixin OS=Rattus norvegicus OX=10116 GN=Dixdc1 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004295 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00307 all species →	CH	Calponin homology (CH) domain	Domain	Interproscan
PF00778 all species →	DIX	DIX domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015506 all species →	Family	Dishevelled-related protein	Interproscan
IPR036872 all species →	Homologous_superfamily	CH domain superfamily	Interproscan
IPR029071 all species →	Homologous_superfamily	Ubiquitin-like domain superfamily	Interproscan
IPR001715 all species →	Domain	Calponin homology domain	Interproscan
IPR001158 all species →	Domain	DIX domain	Interproscan
IPR038207 all species →	Homologous_superfamily	DIX domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10878 all species →	SEGMENT POLARITY PROTEIN DISHEVELLED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005109 all species →	Molecular Function	frizzled binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0016055 all species →	Biological Process	Wnt signaling pathway	Interproscan
GO:0060070 all species →	Biological Process	canonical Wnt signaling pathway	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_018245-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018245-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

19.8Max TPM

8.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.17	11.77
polyp at pH7 6	18	18	6.48	10.35
coral polyp · control treatment	16	16	12.01	17.80
coral polyp · oil and dispersant treatment	16	16	11.21	17.45
coral polyp · oil treatment	16	16	8.20	13.30
coral polyp · dispersant treatment	16	16	10.35	19.78
Polyp	10	10	3.90	5.49

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.77
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.72
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.29
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.23
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.79
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.34
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.80
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.46
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.86
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.93
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.74
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.32
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.37
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.17
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.41
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.30
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.35
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.57
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.23
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.83
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.50
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.46
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.19
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.10
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.05
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.50
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.45
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.44
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.18
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.77
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.40
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.23
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.84
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.80
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.25
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.09
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.80
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.55
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.41
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.71
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.38
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.27
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.01
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.82
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.72
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.54
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.50
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.90
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.45
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.21
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.07
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.91
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.12
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.06
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.94
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.99
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.00
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.37
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.12
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.03
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.52
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.52
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.09
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.30
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.58
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.99
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.32
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.44
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.33
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.84
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.14
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.23
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.16
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.38
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.71
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.50
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.71
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.57
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.78
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.02
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.46
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.25
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.74
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.47
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.78
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.93
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.13
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.94
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.75
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.31
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.90
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.40
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.49
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.78
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.72
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.60
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.36
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.81
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.78
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.42
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.87
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.18

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.