Gene detail

Detailed information of OS493_018365-T1 in Lophelia pertusa

Genomic Location: scaffold_60:2016917...2028900
NR annotation: KAJ7333189.1, Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018365-T1

ATGAAAACAGCCAAGAAAATGGGAATAAGGACTGTGGCTGTTTACAGCGATGCAGATGAAAATTCAATGCATGTAGATATGGCTGATGAGGCTTTTCACATTGGAGCTGCAGATTCGAGGGAAAGTTATCTCAAAATGGAGAAAATCATTGAAGTTGCAATTCAAAGTGGAGCGCAGGCTATTCATCCTGGGTATGGCTTCCTGTCAGAGAAGCCAGAATTTGCGGAGCTTTGTGAGAAGAAAGGTTTGATATTTATTGGGCCGCCAGCCTCGGCCATCAGGGATATGGGTATCAAAAGTACATCAAAGGCAATCATGGGCAGTGCTGGAGTGCCCATCATTGAGGGTTACCATGGCGATGACCAATCAGATGAGAGATTGAGACAAGAGGCAGAGAGAATAGGATATCCTGTTATGCTTAAAGCTGTGAGAGGTGGAGGTGGAAAGGGAATGAGGATTGTTATGAAGCCTGAAGAATTTGACGATGCTCTAGAATCAGCCAGAAGGGAATCTCTGAAGTCCTTTAATGACGATAACATGCTAGTGGAAAAATTTGTCAACACTCCAAGACATGTGGAGGTTCAAGTTTTTGCCGACACCCTTGGGAACACCGTGTACCTGTTTGAGAGAGACTGCAGTGTTCAGAGAAGACATCAGAAAATCATTGAGGAGGCTCCTGCTCCAGATGTGTCTTCAGAGATGCGGCAGAAGATCGGTGAGGCGGCAGTGAAGGCAGCCAAGGCTGTAGGCTATGTTGGAGCAGGCACTGTGGAGTTCATTATGGATAAAGAACAAAACTTCTACTTCATGGAAATGAACACCCGGTTACAAGTTGAACACCCAGTAACTGAGATGGTCACAGGACAGGACCTGGTTGAGTGGCAGCTGAGAGTGGCGGCAGGAGAAACTTTACCACTCGCACAAGAAGACATCAAACTAATAGGACATTCCTTTGAGGCCAGAATTTATGCTGAGGATCCTGACAGTGATTTTCTTCCCGGAGCTGGTCCTTTGTTACATCTATCAACACCTCAGTCATCTGACACAATCAGAGTAGAAACAGGAGTACGGCAAGGCGATGAAGTATCGGTGCACTATGATCCAATGATTGCCAAACTTGTGGTGTGGTCAGAAAACCGAGACCAGGCATTGAGTTTACTAAAAGAATCTCTACAGGAATATAATATTGTAGGATTGAACACAAACATCAACTTCTTGTCAAGTCTGTGTGAACATGGCCATTTTAAGAAAGGAGATGTGCACACAGATTTTATCAAGCAAAAAATACCGCTGAGCCATGAGATGCTGGCCCAAGCCAGCCTGGGACTTCTGCTTCTTGAAAGACAAGAACAAGAAGGACGAGCCACACTCTCAAGCGATCCTTTTTCAGTGTGGAATTCTAATATTAGTTTCAGACTGAACAATGTCGCTAAAAGGAGAATACGCCTGGATGATGGCGACAAAAAGGTATACATCATTGTTTCTTACAACAAGGATGGGAGTTATACATTAGAGGTCGAAGGTCACCGCATGCATGTGAAAGGAAAACTACAGTCAGAAGGCTCACGAACCAGCCTCACAGCTAGTGTGGATGGACGAGTCTTTAAATCCTGGCTTGTTGATCAAGAGGGAACACTGCACTTATTCACCAAGGATGGCTGTCACAAGGTGCATCGCCCGGTTCCCAAGTTCCTGAGGGGTGGTCCCTCAGCAGCTTCCCAAGGTTCCGCGCTGGCGCCAATGACAGGAACTATTGTCAAGGTATATGTTGAGCCAGGACAGAGTGTTGAAGAAGGTGAAACATTAGTTATCATGGAGGCAATGAAGATGGAGCACGTCATTCGAGCACCAAAAGCTGGCGTGATAGAAAAAGTCCTTTTCTCTGCCGGACAGTCTGTGAACAGGCATGCGCAGCTGGTGCAATTCCAAGAACAAGAACAAGAAGAAAAGACCGAGGACGAGTACGAGGACGAGGAAGGGCCTGAGGCCGAGTGA

Transcript

OS493_018365-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96RQ3	Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Homo sapiens OX=9606 GN=MCCC1 PE=1 SV=3
Q99MR8	Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Mus musculus OX=10090 GN=Mccc1 PE=1 SV=2
Q5I0C3	Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Rattus norvegicus OX=10116 GN=Mccc1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001401 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02786 all species →	CPSase_L_D2	Carbamoyl-phosphate synthase L chain, ATP binding domain	Domain	Interproscan
PF00364 all species →	Biotin_lipoyl	Biotin-requiring enzyme	Domain	Interproscan
PF02785 all species →	Biotin_carb_C	Biotin carboxylase C-terminal domain	Domain	Interproscan
PF00289 all species →	Biotin_carb_N	Biotin carboxylase, N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005479 all species →	Domain	Carbamoyl-phosphate synthetase large subunit-like, ATP-binding domain	Interproscan
IPR000089 all species →	Domain	Biotin/lipoyl attachment	Interproscan
IPR005482 all species →	Domain	Biotin carboxylase, C-terminal	Interproscan
IPR011053 all species →	Homologous_superfamily	Single hybrid motif	Interproscan
IPR011054 all species →	Homologous_superfamily	Rudiment single hybrid motif	Interproscan
IPR011761 all species →	Domain	ATP-grasp fold	Interproscan
IPR005481 all species →	Domain	Biotin carboxylase-like, N-terminal domain	Interproscan
IPR011764 all species →	Domain	Biotin carboxylation domain	Interproscan
IPR016185 all species →	Homologous_superfamily	Pre-ATP-grasp domain superfamily	Interproscan
IPR050856 all species →	Family	Biotin-dependent Carboxylase Complex	Interproscan
IPR001882 all species →	Binding_site	Biotin-binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18866 all species →	CARBOXYLASE:PYRUVATE/ACETYL-COA/PROPIONYL-COA CARBOXYLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0004485 all species →	Molecular Function	methylcrotonoyl-CoA carboxylase activity	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01968	MCCC1, accA1; 3-methylcrotonyl-CoA carboxylase alpha subunit	EC:6.4.1.4	Valine, leucine and isoleucine degradation	ko00280	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018365-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

19.9Max TPM

6.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.41	9.46
polyp at pH7 6	18	17	6.30	10.86
coral polyp · control treatment	16	16	8.61	19.17
coral polyp · oil and dispersant treatment	16	16	6.75	19.91
coral polyp · oil treatment	16	16	7.95	13.31
coral polyp · dispersant treatment	16	16	4.82	9.80
Polyp	10	9	5.84	9.96

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.46
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.25
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.17
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.92
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.30
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.02
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.00
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.63
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.66
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.14
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.46
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.22
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.39
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.31
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.11
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.74
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.41
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.15
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.86
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.82
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.77
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.70
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.51
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.10
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.94
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.85
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.80
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.49
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.08
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.76
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.75
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.60
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.67
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.17
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.26
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.23
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.46
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.87
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.62
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.16
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.95
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.94
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.34
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.95
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.09
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.00
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.87
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.18
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.91
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.08
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.27
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.26
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.00
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.91
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.25
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.09
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.24
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.69
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.51
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.31
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.90
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.44
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.38
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.00
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.71
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.02
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.82
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.70
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.64
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.63
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.45
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.30
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.02
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.41
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.71
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.80
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.56
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.21
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.78
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.23
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.78
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.74
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.62
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.53
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.26
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.76
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.79
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.32
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.86
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.41
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.96
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.45
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.51
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.40
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.08
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.81
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.54
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.68
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.99
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.