Gene detail

Detailed information of OS493_018528-T1 in Lophelia pertusa

Genomic Location: scaffold_61:1654680...1674532
NR annotation: KAJ7391481.1, AAA ATPase midasin [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018528-T1

ATGTCAGAGCAATTGAAGCTTAGTCTGCTGGATAAACTTTTTACCATCAACGAAAGAAACTCATTTGTAATTCGTGAATGTTTAGCAAGAGGGTCGTCCAGTTTAGTTCAAGAGTGTATGGAAAGGAATCAATTGATGGATTCTATGGATCTAGATACCAGCAGTACAAGTGGATCATTTTTCAGTGAGGAAGATTTAATTGGCAAGTATACAACCATTTGTGGTGTTGTGTTACCACGGCTACCTGGAACTTCAGATCTCGTGGACAAATCACTTGTTATGTGGCATCGGGCCATGGAGTTTTTACTGGAGGGACATATTGGCTCTGGTAAAACAACTCTAGTCGAGTATCTAGCAAGAGCAACAGGGAGATCAAACCCACCTGAATTTATGAAGATTCAACTGGGAGACCAAACTGACAGCAAGTCCTTGCTAGGTACATACGTGTGTACAGACACCCCAGGTGAGTTTGCTTGGCAGCCTGGACCTCTGTTACAAGCAGTACGAGCAGGGCACTGGATTCTCCTGGAGGATATCGACCTGGCCCCTATGGATGTCATCTCTGTGCTGATTCCACTGCTTGAATCCCGTACACTGTCGGTTCCTGCACATGGAAATGCAGTCAAGGCATCGCCAGGGTTTCAGTTGTTTGCTACACAGAGATCATACAGTGGTCTTGGTGGATCAAGCTACCAAGTAGCTAGTGCTAGTTCTGCTATCCTGGACAAACTGTGGACAAGAGTTCAAATTGAACCCCTTTCCAAAGAAGAACTTACAGAGGTTGTGAATCAGAAATACCCAGACCTTGAAACAGTGGCTGAAAAACTGGTGGATATCTACTGCCTTTTATCATCAGATCCACGACTTGTTTCTAGTCAGGACACAAACTGTTCCCTTCCTCATGACAAACGACTAAGCTCTACAAGAGATTTCATGAAGTGGTGCAGCAGAATAGCCGTAACTGCTTGTGGTGCACCCACACTTCTTGATTCCAAAGATGTTTTCCTTGAAGCTCAAGACTGTTTCAGTGCTCCTTTGCCAAAGACGGAGGATAGAAATTTGTTAGACATGGCAGTGGGTGCCAAATTAGGTTTGACAAAAGAGAAGATTGAGTTCTTTTTTAGGAACTACAAACCAAAAGTCCACGCCTCTCCATTATCACTGACAGTTGGTAGAATCTCTCTGAAAAGAAAAATCCATGATAATATGCCAGTGCGCTTTGGTCAAAATAACCTTCCAAAATTTGCACACACAAGACATTCCTTGGTGTTGCTGGAGAAAGTTGTAGCTTGTATCAGAAACAATGAGCCTGTTTTACTCGTTGGGGAGACGGGAACTGGTAAAACGTCAACAGTTCAATACCTGGCAGCACAGTGCACAGTCAGTTTGAAAGTTGTCAACATGAGTCAACAGAGCGATAGTTCAGATCTTCTTGGTGGTTACAAGCCAGTGGAGATGAAACAGATTGTTGCTCCCGTAAGAGAAACGTTTGAAGTGCTGTTTTGTAAGACGTTCTCAAGAAAGCAAAATGTGAAGTTTTTGAGTCATGTACAGAAATGTTTTGCTCAAGGACAGTGGGAGATGCTGTTCAAGTTAATGGTGCATTGCCAAAAGAATGCTCTAGAAAGGGTGAAGAAAGATCACCAAATGAATCATCTTATTTCCGAGTGGATAAATGTCAACCAGGACATCCAGCAGTTGCGAAAGCAGCAGAAGAATGCAGAGAGTGCATTGGCATTCCGATTTGTTGAAGGCACCTTAGTGCAGGCTTTACGAAATGGTGACTGGGTGTTGCTAGATGAGATCAATTTGGCCACACCAGAGACATTGGAGTGTTTGTGTGGTTTGTTGGAGAGTTCATCCGGTTCAGTGGTGCTCATGGAAAGAGGTGATATTACACCTACTACAAGACATGAAGATTTTCGTCTGTTTGCCTGCATGAATCCAGCTACTGATGTCGGAAAAAAAGATTTACCACCCGGAATTAGAAACAGGTTAACAGAAATCTTTGTCAGTGAGTTAGAGAATACTGCAGATCTGAAGACTCTGGTCGTGGATTATCTGCAGGGATTGTCACCTAATGCAGCCATTGTGGATGGAATTGTTAGGTTTTACCTCACAGTCAAACATGAGGCAAATGATAAGCTGACAGATGGTACTGGACACAAACCTCATTACAGTTTGCGGACTTTGTGCCGAGCTCTAAGATATGCCGCAAGAAACCCTCATCAGAATTCTTTGAGGTCCATATATGAGGGCTTTTGTTTGAGTTTTCTGACACAGTTGGACCGATCATCCCATCCTGCTGTACAGTCGCTCATCAGACAGCATCTCCTGGGCCATGTGAATCCAACCAGCATGCTGAAACAGCCCCTACCCATGCCGCAAGACTCAGGACAGTTCTGTAATTTTGAAGGCTTCTGGATTGCGATGGGCAACAAAGAACCTGTTGTGTCAACTGAGTATGTCTTAACAGCTTCAGTGAAGGCTAACTTGAAGGATCTTGGCAGGGTTGTGTCTGCAAGGAAACTGCCAGTTTTGATTCAAGGTGAGACCTCAGTGGGTAAAACCAGCCTGATTCAATGGCTTGCAAAGGCATCTGGCAACCACTGTGTTAGAATAAACAATCACGAACACACTGATATTCAGGAGTACCTTGGCTGTTACACTTCTGATGAGAATGGTAAACTAGTTTTTAAAGAAGGTGTTTTAGTCGATGCCATGAGGAAGGGCCATTGGATCATTTTAGATGAACTCAATTTGGCCCCTTCAGATGTGCTGGAGGCCCTAAATAGGTTGTTGGATGACAACAGAGAACTGTTTTATTCCTGA

Transcript

OS493_018528-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9NU22	Midasin OS=Homo sapiens OX=9606 GN=MDN1 PE=1 SV=2
Q869L3	Midasin OS=Dictyostelium discoideum OX=44689 GN=mdn1 PE=3 SV=2
Q12019	Midasin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) OX=559292 GN=MDN1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001659 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17865 all species →	AAA_lid_5	Midasin AAA lid domain	Domain	Interproscan
PF07728 all species →	AAA_5	AAA domain (dynein-related subfamily)	Domain	Interproscan
PF17867 all species →	AAA_lid_7	Midasin AAA lid domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR041190 all species →	Domain	Midasin AAA lid domain 5	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR011704 all species →	Domain	ATPase, dynein-related, AAA domain	Interproscan
IPR040848 all species →	Domain	Midasin, AAA lid domain 7	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48103 all species →	MIDASIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0000027 all species →	Biological Process	ribosomal large subunit assembly	Interproscan
GO:0000055 all species →	Biological Process	ribosomal large subunit export from nucleus	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0030687 all species →	Cellular Component	preribosome, large subunit precursor	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_018528-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018528-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

93TPM > 0

7Conditions

4.8Max TPM

0.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	15	0.92	1.98
polyp at pH7 6	18	11	0.75	1.93
coral polyp · control treatment	16	16	1.15	2.55
coral polyp · oil and dispersant treatment	16	15	0.83	2.62
coral polyp · oil treatment	16	15	0.67	1.13
coral polyp · dispersant treatment	16	15	1.27	4.81
Polyp	10	6	0.07	0.19

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.98
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.54
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.26
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.23
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.22
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.15
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.13
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.02
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.93
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.88
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.87
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.85
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.76
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.70
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.93
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.84
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.52
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.30
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.27
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.22
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.20
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.02
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.73
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.38
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.31
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.13
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.59
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.44
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.36
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.31
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.25
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.12
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.86
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.78
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.66
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.53
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.20
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.17
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.12
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.62
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.56
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.27
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.15
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.08
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.82
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.73
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.49
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.43
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.38
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.31
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.21
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.13
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.13
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.03
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.02
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.99
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.81
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.73
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.62
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.61
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.60
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.59
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.54
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.46
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.31
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.16
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.81
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.66
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.11
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.41
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.40
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.29
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.11
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.04
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.82
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.77
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.73
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.71
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.40
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.36
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.19
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.18
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.17
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.10
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.07
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.03
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.