Gene detail

Detailed information of OS493_018662-T1 in Lophelia pertusa

Genomic Location: scaffold_62:806514...847735
NR annotation: KAJ7384973.1, GATOR complex protein wdr59 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018662-T1

ATGGCGGCCTACCAGGATGTTGTTGCACCACATCAAGAATGGCCCGCAACAGTCATGGCTGTGGACTGTACGGGCCAGTTTACTGTCTTAGGATCACGTAAAGGACTGGCATTTATTGACTTAAATGCTCCTTGTGTAATCACGAAAAAGGTGACAAGAAACAGTAAGTGGGAATGTGGTGCGGTGGAATGGAACCCTCACCTCTCACATTCTCATATATTTGCCAATGCATCAAATCAAAAGACAGAGATCTGGGCATGGAGAGATGGTAATGGCTTACAACAGCATATTCTCAGAGGCCACACCAGATCAATTAGTGATCTTAATTGGTCATGGTTTGACCCTCAGCTTCTCTCCACATGCTCAATGGATCAGTTTATCTACATCTGGGACTTGAGGGATTGGAAAAAGCCAGCCAGTTCACTGCAAGCTATTGTTGGAGCTTCACAAGTCAAATGGAACAGAGTGAACCGTCATGTGCTGGCAACCAGTCATGATGGAGATGTTAGAATCTGGGATCTTAGGAAAGGTAACACCCCTGTGGTGTATGTCACAGCTCACCTATCTAAAATTCATGGACTGGACTGGTCCCGTTCTAGTGGCACAACACTAGCAACATGCAGTAATGATTCTACAGTCAAGTTGTGGAATACAGAAAACCCTCGCCAACCAGAAAATAAATTAAATGCAAATTCCCCTGTCTGGAGGGCAAGATTCACGCCATTTGGTGAGGGTCTTGTTACAGTCACTGTACCTCAATTGCGGCGAGGAGAAAACAGCTTGTCATTATGGAACATCCTGGACATCAACTCACCCAAGTCGCGTCCTGTGAACACATTTGTTGGCCACAGTGATGTTGTTTTAGAATTCCAGTGGAGATCTCAAGCACTAGATGATGAGGAACAGTTTCAACTCATTACCTGGGCAAAAGATTACACCCTCAGACAGTGGGTAATAGAGCCAAGGATGATTGCGGCCTGCAGCGGAGATGTTCCAGACAATTTTCCATCTCAGAGCACAAGTGACACAGGCCTGTCTATACGTGATGATTTGTTAGAGTCAGTTCTTTCAGAGTCCGTTATTATTGGTTCAGCTGAAGTTATTCCTGATATCGCTGTTCAGCCACACACTTTACAGCAGGAGTTTGCGCTGATAAATGTTAACATCCCTAATGTGATCGTTGAACAGATGGACGCAGGCCATAGGAGCTGTACGGTGAATGTTACCAATGGCCCTAATGTTGTATCGTTAGTAATAAATTTCCCTGCTCACTACCCTAACAATGCCATACCGTCATTTGAGTTTACACCTGATACTTCCATTGACGTCAATACCAAGACGAAACTAATGAAGACTTTACGCGAAACAGCTCAGACGCATGTCAAGTTAAACCAGACGTGTCTGGAGCCATGCCTCAGACAATTGGTCAGCCATCTTGAAGAATTGACGCTTCAAGAAGATTTACCCATGGACCAATACGACTCAACCGTTCCCCAGATTCACGGCAGGCTCGACCCAGTCTCCTATGGTAGTTACCTTGATGCAGCTATTCCATTCCCGCGTACGTCTGGCGCGAAATTTTGCGCTTGCGGATTACTGGTTTGTTTCAATCTACCCGGAAGATATAGTGGCCGTGTAGGGTCTGGTGGAGAACCAACTCCAAGGTCCCTGTCGGCCTTCTCAGCATACAGTTCTCGCCCCAGTAGTGGCCCTGCCCTTCCACCTCTCATAAACAGCTCGCTTCAGAAGTCTCACCACAGACATACATTTAGTTCATTTGGTCAGCAGTCATCCTCTAGGACCATGATCTACAGAACGTTAAGCCAGCAAGAAGATCTACACGAGGGACAAAAGTACAGTGGGATCACTTCACGGAACAGCGATGTTGGCCTCGTTGTGATTCGTGACGTCAGTGTCATGATGCCCATTCACCAGTCACTGGGACAAGCTTACACGCTTGAAGGGAATGATATCACTGAAATTTGTAAGAAGAACCTATCGGCTGCCATGACAACCGGCCGCAAAGACCTGGTGCAGACGTGGTCCCTATTGAGCTTAGTCCTCGACAGGAAACTTGCGCCCTCTGACTCGATGGATGAGTCGCCCTGGGCACTACATCCGTTTGGTCGGAAGATGGTCAGTTCACTAATGGATTACTACTTAAGCATCCGGGATATCCAGATGTTAGGAATGCTGTCATGCGTGCTGGTTCATCCTTCTCTCCCAGACTCCTTCAAGCCGCCTAAAACCATCTCTAAGCCAGACATCATTGCCTCAAGCAAGTCTTTTTCGTATGGCTCTTCTCCACAATACGCTGACGCCCCTTATCAGTCTATCAAGCGGCCCAAGTCTCTTGGTAATGTCACAGATCATCCAGCTGATCTGTCTCCAGCAGATGATCAATGGAGCGAGATCTCATTCCCTCTGAGTGGTGGATGGTCGCCTCCTGTGTTCATTCGTGCAAAGGATCCCCGCGAAGAACAGCGGAAACAATACGAAAAAGACTCTCGATTTGTTGATGTTTCAAAACTTCCATTACATGATCACTACATGAAGCAGTACGCCGATGTTCTGTACCGCTGGAATCTGCTGGGCAAAAGAGCCGAAGTGATCAAATTCTTGAGTGAGCCTCAACAGGCACATAATGGAGTCGAATTCAGTACTCGTTGCCATAACTGCTCGCAGATGCTTCGTGGAGCCCAGTGCTGGTCTTGTAAAGCTTTGGGTCTTCAGTGCGTTATATGTCATGTAGCTGTTAGAGGAGCCAGCAATTTCTGTGTAGCGTGCGGTCACGGGGGCCATACTTATCACCTCATGTCTTGGTTTGAATCAATGGACGTGTGCCCTTCAGGGTGTGGCTGTAGATGCTTAGAAGTTGGTACATTTATCGTGGATTGA

Transcript

OS493_018662-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6PJI9	GATOR2 complex protein WDR59 OS=Homo sapiens OX=9606 GN=WDR59 PE=1 SV=2
Q5ZLG9	GATOR2 complex protein WDR59 OS=Gallus gallus OX=9031 GN=WDR59 PE=2 SV=1
Q8C0M0	GATOR2 complex protein WDR59 OS=Mus musculus OX=10090 GN=Wdr59 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003114 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17120 all species →	zf-RING_16	RING/Ubox like zinc-binding domain	Domain	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR049567 all species →	Family	GATOR complex protein WDR59-like	Interproscan
IPR049566 all species →	Domain	WDR59/RTC1-like, RING zinc finger domain	Interproscan
IPR039456 all species →	Domain	WDR59, modified RING finger, H2 subclass, C3H3C2-type	Interproscan
IPR006575 all species →	Domain	RWD domain	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46170 all species →	GATOR COMPLEX PROTEIN WDR59	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005774 all species →	Cellular Component	vacuolar membrane	Interproscan
GO:0034198 all species →	Biological Process	cellular response to amino acid starvation	Interproscan
GO:0035591 all species →	Molecular Function	signaling adaptor activity	Interproscan
GO:0035859 all species →	Cellular Component	Seh1-associated complex	Interproscan
GO:1904263 all species →	Biological Process	positive regulation of TORC1 signaling	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20409	WDR59, SEA3; SEA/GATOR complex protein SEA3/WDR59	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018662-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

13.8Max TPM

6.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.99	10.94
polyp at pH7 6	18	18	7.82	12.40
coral polyp · control treatment	16	16	7.54	13.79
coral polyp · oil and dispersant treatment	16	16	4.72	8.55
coral polyp · oil treatment	16	16	6.43	10.28
coral polyp · dispersant treatment	16	16	5.47	9.56
Polyp	10	9	2.50	5.56

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.64
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.17
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.98
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.14
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.80
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.48
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.89
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.77
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.68
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.32
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.27
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.14
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.96
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.98
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.67
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.70
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.40
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.67
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.56
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.39
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.36
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.58
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.58
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.38
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.18
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.00
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.81
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.71
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.61
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.59
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.57
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.87
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.31
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.11
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.79
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.54
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.62
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.66
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.13
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.50
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.08
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.59
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.16
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.94
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.74
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.51
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.63
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.74
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.55
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.34
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.70
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.46
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.31
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.19
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.93
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.92
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.59
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.56
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.23
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.62
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.05
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.99
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.69
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.32
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.24
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.07
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.73
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.60
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.41
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.39
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.10
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.78
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.62
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.36
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.23
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.06
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.97
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.84
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.25
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.56
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.79
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.63
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.86
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.20
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.23
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.20
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.45
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.10
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.70
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.21
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.05
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.32
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.94
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.30
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.56
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.56
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.46
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.75
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.31
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.84
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.44
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.78
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.