Gene detail

Detailed information of OS493_018678-T1 in Lophelia pertusa

Genomic Location: scaffold_62:963023...975195
NR annotation: KAJ7384989.1, beta-catenin binding [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018678-T1

ATGTCTGCATTCGGAACGTTTAACCGAGCGGTAATACAGGAATGGAAGGTGCAAGTCAAGGCTGGTGATAGTGGAAGTCCCACAAAGACGAATACGACCTTTGTGTATATTGATGTAGAGCATAATGGGAACGAAAACGAACCAGAGGATGGGAGCATGATGATTATTGTGAACGCTTACAATGGCAAGTTTGCCGGTGGCATTATCGGAAAGGCTTACTACAAAGATGATGACTATGGAGGTGACAGGAATAAGTATACCATGGCTTCCCAGGAATACTTCTCCATCAATGAAGGGAATGGTAACATCACTGCAGTGGCAAACATTCCTCTAGGGAGGTACACATTCCAGATACAAGTGGAAGAACAAAAGCAGCGGCCTGGGAATTTTCAAAGACTCGTAACTAGTGCAGCGATCAAGCAAAGTGTGGCCGTGCAGATCTTTAAGTTGAGGAAAACGTCGTTCTTTGTGGGTGACTACTACGACAACATTTTCAAAATTCTCGGCGATGGCAGTCTGATCTTCAGCATCCAAAAAGCCCCACTCAACCGCGTTCCTCTCGCTGATCAGTTTGGAGTGGAGATTTTCCTGGCTGTGCAGTTTGGCAGATGGCGGATTTATGAATCAGATGAAAGTTGTGGAGTGGTTGGGCTAACGATTGGAAACATTGGCATTGATGCATGTGCATATGAACAGCAACACGTTGGAAAATGCAGCAATGTTGTTGTAGCGTCTTCCGCGTTCACCGTGCCAGACAGGAATTGTAGCACGGCGGGCACGCCCTGCCTGCATGGAGGCACGTGCCACAATGCTGTTCCTAAGGGGATTATCTGCGAGTGTGGTAGGGATTACCACGGACCCGAGTGCCAAAGTACCACCAGGACATTCATTGGTACTTCGTATATCCACCTGGAGAAGCTGGTCGCCTACGAACGTAGCGCAGTCTCACTACAGTTCATGACGGGAACGGCAGATGGGCTACTGCTCTACCAAGGACCTCATTATAAAGGTGCCAACAATGGTATACCAGATGTGATGGCCTTGATGTTGGTAGAGGGGTATGTCAAGCTTGTGATAACTCTTGGACCTCATCCCAATGCCCCTCTAGAGCTGTACATGAACCGGGGAGACAAACTGGATAATAAGCAGTGGCACACAGTTCAAATCATACGAAACCTCAAGAAAGTAACCCTGAGGATTGACAAATGTGCTCACTCTCAAATTGTGGAAGATAACGGTCAAGTTATGGAAAACAGGGCCTCGTGTGAGATCGAGGGCGAGATCTGGGGCTCCTCCATCTACCTGAACGGATTTGGTCCGCTTCAAATTGGAGGCGTGGAGACCAAGCTGGATAATCCAAAGATCAACTACGGCGGATTCATAGGCTGCATCCGGCGTGTAACCGACGACATTAAAATGTACGATTTGGAGAATCCATTAAAGGAAGTGAATACAAAGTTGGGATGCAAACTTGACAATAATGCGTGTCCAGACTGCAATGGTCATGGATATTGTGAGCCTTTGTGGTATAAAAGCATCTGTGTGTGCGACCTTGGCTATACAGGAGTCGACTGTTCAGCAAGATCGTATGCCAACTGGTACAAGCCCAATAGCTACACTCAGTACCAAGTAAAACAGGCCAAGAGGAAACGCCGCGAACTCGTACCCCCACCAGTGTCTATGGCAAACGAATTCTACACAAACATCGCTTTGCAAGTCAGGATCTCGCCCAATTCTTCCAATGTAGTTGTCTTCTTGGCTTCCAACAGCTTGGGAACAGAGTTCAACAGGATTGATGTCAAGAATCACGTGTTGCGTTACATCTTCCGACTGGGTGACCGCATGAAGATCCTTAGCATTCCTCAACTAAACGTGACAGATGATAAATATCATGCCGTTATAATCAAGAGAGAGGGCAACCGCGCAAGCCTTCAGATCGATTACCACGGTAAAGTGGAGGGGACCACGGGTGGCGTACACAAACTGCTCAACATGGGAGGAGGAAGTTTCTTCACCGGTGGCTTGCCTAACGTCACTGAGGTGAGAGTCGTGGAAGCCTTTGTTAACAGTGGCGGTAACGCTATCTTGCGTACTGCTGACGGTAATATCATCTCAAGCGGGATAGGAAGCGGACTAGCAGGCTATGGATCCTCCTCCAATTCAGAATTCATGGGTACTGACATCATCGTTGGATCCAGAGGACAGGTTTACACATACAACACCTTCCTTAAAATGTCTTCCTTCTACGGAATGCGAGCCGTTTCAAGTAGTAGAGGCACTGTATTTATAGGAAGTGCTGGACGTTCAAGTATAAGTACCTATAGCCAACAGTCTTACACGCCATCGGTGCCAGTAAAAGCGGAAGCTTTGTTAGTAGAAGCGGAAGCTTCAACCGGAGGTGGTACTGTAGTTGGTGCTGCAGGTGGAGCTGCAGGTGGTGCTTCTGGCGGAGCAGCTGGTGGGGCTTCTGGCGGAGCTGCTGGTGGTGCTTCTGGCGGAGCTGCTGGTGGGGCTGCTGGTGGTGGGGCTGCTGGTGGCGGGGCTGCTGGTGGTGGGGCTGCTGGTGGCGGGGCTGCTGGTGGTGGTGCTTCTGGCGGAAGCGGTGTTGTAGTTGGTTCTTCCGGCGGAAGCGGTGGCGGAGGTATAGTAACTGGAGCCACGGTTTTAGGAGGTGCCGCCTCCCTAAATGCATACGGACAACTCACTGCTTATGGTCAAGGTATGACTGGGTGGACTCTTATGGGTGCTACCACTGGTGCGGAAGAAATCGAAGTAATTGGAGATTTTGGAGGCTGTACCGCATCAAACAGCTACAACGGTGTAGATTTGGATAACGATGAGAATATAGTGGCTCGGCGTCAGAACGTAGAATTCGGCTGTCCGTGTGCAACAACAGGTTTCTGTCTACATGGCGGAACATGTGTCAATGCTGTCCCTCCCTACTGTATGTGCCCGCCTGGGTGGAGTGGACTTACTTGCCAGAATCCTGTCACAGAGCCTAAACCAGGAACCCGTCCAGGGACCCGATTCGCCAATCCCGCTGTCATTGCGTGCGTCCTGGTCATTATACTGGCAATATTGGCCATCATCGGCGCCGTGCTACTCAAGAGGCGACCGCAGCCTACCGTCGTGGCTGTCGTCGAAGACGGGCACGTTCACGACAACGTGCGACCGTACCACGACGAAGGCGCCGGCGAGGAAGACAACTTCGGCTATGACATCACGCAGCTTATGAAATACACGTACGTCGAGAACGGTGTAGCCAGTGCAGATGGTGGCGGTGGAATTAACGAAGAGGAGTTCACTGTAGCGGAGAATAAGCCGCTTCTGCAAGGCGCGTTGCCCGGTGCAGGCTTACAACACGGGGTTACCACTACCACCAAGCGTCGTGTGGTACATCCTGAAAGCATCGACGTCAAACAGTTCATCGATACGCGGGTGCACGAGGCGGACGGCGAGTACATCCTGTCCATTGACGAGTTGCACATTTATCGCTACGAAGGAGATGACTCGGATGTCGACGACCTAAGTGAGCTGGGAGACAGCGATGAAGAACCAGATGAGGAAGAAGAGCAGGAATTTGCTTTCTTGCAAGAATGGGGCAAGAAGTTCGACAATCTCAACCACATTTTCAACGAAGAGGATTAA

Transcript

OS493_018678-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B8V7Q1	Protocadherin-like protein OS=Acropora millepora OX=45264 PE=1 SV=1
Q00174	Laminin subunit alpha OS=Drosophila melanogaster OX=7227 GN=LanA PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000983 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00008 all species →	EGF	EGF-like domain	Domain	Interproscan
PF02210 all species →	Laminin_G_2	Laminin G domain	Domain	Interproscan
PF01049 all species →	CADH_Y-type_LIR	Cadherin, Y-type LIR-motif	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR001791 all species →	Domain	Laminin G domain	Interproscan
IPR000233 all species →	Domain	Cadherin, Y-type LIR-motif	Interproscan
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan
IPR050372 all species →	Family	Neurexin-related cell adhesion and synaptic protein	Interproscan
IPR027397 all species →	Homologous_superfamily	Catenin binding domain superfamily	Interproscan
IPR001881 all species →	Domain	EGF-like calcium-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15036 all species →	PIKACHURIN-LIKE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0007156 all species →	Biological Process	homophilic cell adhesion via plasma membrane adhesion molecules	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_018678-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018678-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

181.8Max TPM

83.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	72.80	112.76
polyp at pH7 6	18	18	62.36	93.47
coral polyp · control treatment	16	16	106.44	163.02
coral polyp · oil and dispersant treatment	16	16	115.08	181.79
coral polyp · oil treatment	16	16	80.77	126.58
coral polyp · dispersant treatment	16	16	100.04	170.86
Polyp	10	10	32.77	56.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	112.76
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	112.36
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	111.03
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	105.82
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	96.28
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	94.45
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	76.52
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	71.31
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	62.76
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	62.20
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	60.99
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.91
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	57.30
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.40
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.26
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.03
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.17
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.78
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	93.47
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	93.12
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	75.33
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	74.98
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	70.98
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	69.94
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.46
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	67.64
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.62
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.88
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.94
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.42
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.41
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.17
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.77
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.78
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.83
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.75
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	163.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	152.44
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	136.51
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	133.83
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	126.94
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	119.10
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	118.55
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	111.02
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	109.53
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	92.21
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.29
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	84.74
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	84.29
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.90
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.65
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.08
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	181.79
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	171.11
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	155.47
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	153.53
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	144.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	129.03
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	121.42
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	114.47
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	114.36
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.70
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.49
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.98
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	81.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.76
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.81
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.72
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	126.58
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	118.36
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	107.51
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	99.05
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	88.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	86.39
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	85.17
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	84.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	84.28
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	82.89
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.06
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	63.65
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.63
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.70
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.32
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.77
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	170.86
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	156.27
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	145.09
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	118.58
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	112.88
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	106.74
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	103.15
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	100.37
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	99.93
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	98.62
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	91.89
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	91.85
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	87.55
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.35
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.38
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.06
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	56.91
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	50.13
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	46.43
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	42.18
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	36.78
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	29.05
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	25.32
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	15.75
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	13.23
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	11.97

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.