Gene detail

Detailed information of OS493_018700-T1 in Lophelia pertusa

Genomic Location: scaffold_62:1250626...1274197
NR annotation: KAJ7385011.1, enhancer of mRNA decapping 4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018700-T1

ATGGACGATAATGCAAGAGGAGTGGCCTCTAAAATACTCTGCGACCTTCTCAACATTGCAAAAGGAGGAAACACGGCCACTGCTAATGAAGATAATAAAGTTGGTAATGGTTTAGAAAGACAAAGAATTGGAGAAAGAGATGCTGATGATTCTATAAGTGAAACAGCATCAACAGCAAGTTCACTTTCACCTTTAAGAAGGGGAAAGGAACAAATGTCTGATGTGTCTACATCAGATAGTGAAGGAGTTACTTCAAGAATGTCGCTTGAACCTGTGAAACAAATCATTCAGATGACAGGCAATGATAATGAAAGCAGTCAGTCAGTATATGGAAGTGATGTTGAAATTGTAACTAGTGAAGCATCCATTTTAACAAGTGCCACAGCTAGTAATAAGATTAAATTCAATTCAATGGTGAATTATGACTGGGAGCTGAGGTACTACAGAGGATGTCTGATAGCTGTTAGCAGCAAATGTATTGCTTATGCTCTCAGAGGCCGTCAAGGCTATGTTGTGAGGCTTCTCAACCCAGAGACAGCCTCAAGGACACTGATCAAAGGATTTGTTGGTATGATCAGTGAGTTGGCTTTTTCACACAAAGATTCCAACACCTTGGCATGTGTTGATGAGGGTGGTAATGTTTATATCTGGGTTATCCATGAAGAAAATGGTAAACTCGAATACTCAGTAAAACTTCACATTAAACGTCCTGCTAGCACACTGTCTGAGCACCACAGACTAATATGGACTCCATATATGCCTGATGCCGAGGCTGAGGAATCCACTGGAGAAGAAGGACGTCCACTGGCCATCACACATGGAAATCAGGTGGAGGTAATAGATATTGATTCATTGACTGAATGGTGTGGAAGAACAGAAGTGTCCATCGATGAAATACAACAAGGAGAAGGATATTTGGAAATCAAAGATGGGCACACCAAGCCGATCTCAGAAGGAGCTCTATCACCAGATGGGTCAGTGCTAGCGACAGCCAGTGAGGACGGTCACATCAAGTTTTGGCAGTTGTCTGACAAAGTAGAGTGCATGCATGAATTCCAGCCCCATGGTGGCTTGCCACTGTCCTGTATGATTTTTACTGATAATCAGACTTCACAAGATAAAGATCTTCCAATGTGGAGATTTTTAATCACAGGCGCTGAATTCAACAGAGAGATTAAAATTTACGTCTCCAGATGTTCCAAGCTCCAGCTCTTTCCATCGCTCATTCCTAAAGTGAACTTGGATCTCTCAGCTTCATATTTGGTAATTTCAGATGTTCTCAAAAAGGTTCTTTATGTACTTATGTTCCATCAAGACATTGAAGAAGGTCAAGCACATGTCACTTCAGTGGCAGAGTTTCTTCTCACACAACCATTACTAAGTTTTGTTGTTGGTCAAGTCAAGCTGTTCAAACTAAAATCACATAGAGAGCAAAATGGGCAGGAAAATGGAGAAAGCAATGATGAGGATGATATTCACTCCACGCATGTCGGGCTGGAAGAACTAGCTGCTGGAGATGAAAAAGGAAAGAAATATGGTGTTCAGCTGCAGCTGTTTTGCATTCAAACCAAGGCAATGCAAGAGCTCCTGGTACATTTCCAGCCCGAGCCATCTGTCCCACCACCTACACCATCAACTCTGTCATCACTTACAACTGTAGCAGGTCAATCTGTTATACATGATGCCTTGTCTGACTTAAGTGGGATAGATACTGAAACAGAAGCAAGTACAGATGTCGAGGATCCTGATGAGAGTACAGATGAACCTTTCCCAACCAGAGCTAAACTAATCACACCAGAGGCCTTCACCAACACTGCATCCAGGGGCTCACCCCGCCCTGAAGCACTTGGCAGCAGTGGTGGTAGTAGTGTCACTATGGTTTCTGGACTGAATAACTCGCAGGCATCAGTTGACGAGCTTCTGGGTTCATCAGTGTCGTCAAGACTGTCTGACACTACTGTCAGATCAAGTAATTCAGCCACACCTCATGGGTCTTTCATTCATGACAGTGGTCTTCTAACACCAACATCCTTACCCCTCCCCCCATCACCAACTATAACACAGGCGCCTGATCCAAGTGCAATTCCTATTCCAAATTTCCGGTCTAGTCCTCGTGCAGTGTCAGTTCAAAATGAGCCAAGTCCGATATCATCAAGTCATGAGCCTTTAGTGCCTGTTACAAACACTGAAACTCTAGCTTCGGCTTATGGTTCGATAAACAGATTTGTAGAGAATGGTTCAAGTGGTTCAAAGAACCCTTCTCTCAATGAAAAGAGCAGATCCGGCAGTCCTGGCAGTGCAGAAAGAGATATTGAAGTATCCATTGATGACGATGCTAAGGACACAGGTGAAGAAGAGTTACCTGAATCTCAAAAATCTGAGGCGGAAACACAAGAGGAAGTAAATGAACGCGACAGGAAATCCAGCTCAGGATCCAGTACAAGTGAAAGTTTGAGACCAATGTCCGCTCACGCAGAAGGAAATCTTATATGTTTAGAAGATATCGGCAAGGGTAAAGGTGATGTTGTGCAAGTAGATGGGGAAGACATGTTCACAGAAGGGAATCTGTTAGAGCAGTGGGGAATGAACGTCGATGATGAAGTTGTTCCAACTGGACGAGAAAGTCCCGAGTCAGCACATGCACTTCCTGTTGGTACACCAATAGAATCCAGTGGAGGAAGAAAGCGACCTTCCTCACTCTCAAGTTTTGTTTCCACACCTGTAACTGCAATGGATATTCCTCCACAGCAAGTCCAAGTTGCGATGGATGGTAGTATCTTGACATCACTTGGAGAACTCCTGAGTTTGGTGAAGTCACAACAGAAGGACATCAGTGAACTTCGTCAGCAACTGGACTTGTACCAGACTGATCAACAGCAGAAGATGACAGCAGTAGTGCATGAAGTGCAGATGGTCGAGGAGAGAGTATCAACCAGATTGGGAAGTACTCTGGCTGAGTTTTCCAAGGATGAATCTCAGCGTCTTGACAAAGCTCTGCGAGAGAAACACTCAGGAGATAAGAAAAGACACGAACAGCTGCAGAGTACCCTGTCGCAAACCCTTACTACCACCCTGTCAGGAAAATTAGACAAAGCCGTCAAGGCAGAAGTGAAGAATGCAGTGGTACCGTCAGTACAGAAAGTATTGAACTCTCTGCAGGAACAGCTCAACACAACATTGGCACAGAAACTAACCGCTGCTGATGCTGTTTTGAAGGAGAGTATTGCTAAAATGGTGAAGAGTAAGGGAGTGGTAGATGCTATTGGTGGGGCTGCAGCAAGTGCGCTTCAGGGACCTATTCAGGTGACTTACCGCGAGGCATTCCAGAGCACCATCTTGCCATCATTCGAGAGGGCATGCCAGAACATGTTCCAACAAATCAACGACTCATTTAATAAGGGAACTCAACAATACCTGCATCAGGTTACAACTGCTCTGGATAACCGAAGAAGAGAAGAGAAAGAATCTCTAGACCCTGTAATGCGACAGCTGGAATCACAGACACAGTCATTCCAGGCAATGACAGAGAGGCTTTCATCAAACATTATGGCTGACTTTGAAGTCATGTTACAGAAACAATTGGCATCATCAATAGAAGGTTTACGCGAGGAGATTTTCTCACGGCTGTTGTCAGAGGTCTTAGCTTCAGTCCAAGACTCAGTTCAAAAGGAAATGGGATTGGGCTTGGAAGGCCTACGTCAACAGTTGAGTGACATGATAGCCTCATCAGGAGAAAGCACTTCACAACAGGCTCCTGATATAGCTCGTACTCAGGTTGTAGTTTCCAGGCTGCTGGAATCTGGACAAGTGGGTTCAGCATTCCAAGAGGCCCTGACAGCAGCAGATCTAAACGTTGTGATGTACGTGTGTGAAAATGTGGATGTGGAGAATGTGTTTTCTCAGACACCTTGTCCTTTATCACAACCAGTCTTACTGTCTCTAATACAACAACTGTCTGTGGATCTCACCATCAACACAGAGCTCAAGCACAAGTACATTGAAGAGGCTCTCATGTCCCTGGACACGCATGATGATGTCACAAGAGAACACATGCCAGGAGTTCTGGAAGGATTATGCCAACAACTTCAATCTGCTATCCAAGAAGCATCAGGTCCCATGCAACGTTCTCTAAAGATGTTACAAATGGCAGCAAGGTCACTTCTTAGATAA

Transcript

OS493_018700-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q1LUT1	Enhancer of mRNA-decapping protein 4 OS=Danio rerio OX=7955 GN=edc4 PE=3 SV=1
Q7ZXT3	Enhancer of mRNA-decapping protein 4 OS=Xenopus laevis OX=8355 GN=edc4 PE=2 SV=1
Q6P2E9	Enhancer of mRNA-decapping protein 4 OS=Homo sapiens OX=9606 GN=EDC4 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003906 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21289 all species →	EDC4_C	Enhancer of mRNA-decapping protein 4, C-terminal	Domain	Interproscan
PF16529 all species →	Ge1_WD40	WD40 region of Ge1, enhancer of mRNA-decapping protein	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR049404 all species →	Domain	Enhancer of mRNA-decapping protein 4, C-terminal	Interproscan
IPR044938 all species →	Homologous_superfamily	Enhancer of mRNA-decapping protein 4, conserved C-terminal domain superfamily	Interproscan
IPR032401 all species →	Domain	Enhancer of mRNA-decapping protein 4, WD40 repeat region	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR045152 all species →	Family	Enhancer of mRNA-decapping protein 4-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15598 all species →	ENHANCER OF MRNA-DECAPPING PROTEIN 4	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000932 all species →	Cellular Component	P-body	Interproscan
GO:0031087 all species →	Biological Process	deadenylation-independent decapping of nuclear-transcribed mRNA	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12616	EDC4; enhancer of mRNA-decapping protein 4	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018700-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

70.8Max TPM

32.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	31.22	51.04
polyp at pH7 6	18	18	31.58	55.10
coral polyp · control treatment	16	16	38.34	57.85
coral polyp · oil and dispersant treatment	16	16	34.42	47.81
coral polyp · oil treatment	16	16	32.93	47.04
coral polyp · dispersant treatment	16	16	27.62	48.09
Polyp	10	10	29.11	70.81

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.04
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.91
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.34
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.06
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.22
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.90
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.87
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.85
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.10
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.11
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.57
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.35
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.81
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.65
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.85
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.65
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.89
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.85
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.10
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.75
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.54
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.55
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.79
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.85
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.06
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.63
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.14
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.65
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.40
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.92
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.26
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.24
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.97
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.08
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.85
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.79
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.98
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.72
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.59
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.60
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.65
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.26
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.07
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.74
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.57
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.73
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.88
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.10
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.58
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.81
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.98
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.37
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.81
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.13
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.90
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.07
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.87
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.87
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.87
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.67
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.16
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.55
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.34
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.25
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.09
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.04
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.60
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.33
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.53
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.66
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.29
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.18
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.15
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.50
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.00
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.36
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.06
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.77
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.37
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.86
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.24
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.09
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.66
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.92
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.82
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.42
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.47
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.82
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.81
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.73
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.33
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.27
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.96
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.75
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.11
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.35
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	70.81
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	40.91
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	34.02
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	27.44
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	25.78
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	23.09
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	21.93
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	20.31
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	16.50
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.33

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.