Gene detail

Detailed information of OS493_018701-T1 in Lophelia pertusa

Genomic Location: scaffold_62:1274746...1283736
NR annotation: KAJ7385012.1, RNA polymerase II [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018701-T1

ATGGCGGACAGAAAGGCAAGAGAAGTTGTTATTTCAACCTCATCCTCTGCAAAGCTGTTACGATGGCGAGTTTCCGTTGGCACAGAGGTTAGAGAAGGAAGTGTTCTCTGTTTCTATGAAGTTGTTGGCGAAGCAGAGAGGCCTGGATCGTTTATAACTCAGCCGAAACTTAAATCCGCTTTTGCTGGTAAAGTCCGTGAGTTGCTCGTCTCTGAAGGAGAAATCGTTGCAGCCAGGACTCCAGTGCTGTTGATAGATGAAGCACCAGAGTGCGAACATAGGATGATAATGAAGGACCTCTGCTGTGACTGTGGTGCTGACCTCAGGAAACTTCATGAAGAACACGATGAACCTTCTTCACCAACCCTGGCTTCTGTACCACTCATACACAACATCCCTGAGCTGAAAGTGAGCCAGCAGGAAGCTGAGGCATTGGGCAAAAAGGATGAGGAGAGACTTCTTCAAACTCACAAACTGTCACTTGTTGTGGATCTGGACCAGACTCTTATTCACACGACTATGGAACTGATACCAGAAGACATGGTGGATGTCCATCACTTCCAACTGCCTGGTCACCCTGTGTGGTACCACACTAAGATCAGGCCTGGAGCTGCAAACTTCCTGGACCGTTTAGCCAAACTGTACGAGCTGCACATCTTCACCATGGGGTCACGAATGTATGCTCACACCATCGCCAGGATGTTAGATCCTGCTGGTAAACTGTTTGCTCACAGGATTCGCTCGCGAGATGAATGCTTCAATGCATTTTCTAAATCTCATGATCTAAGGTCATTATTTCCTTGTGGTGATACCATGGTTTGCATAATCGATGATCGAGAAGATGTTTGGAATTTTGCCTCAAACTTGGTCCACGTCAAGCCTTACCAGTTCTTCAAGGGAGTGGGGGACATTAATGCCCCACCCGGTGGCTCTTCTCCCCCTGAGGAAGAGAGTACCTCCCCCGAAGAACCTGTCGATGTAACGGAAACACAGGAGGGTGACGTCAAACCTGAAGAACAAAATTCTCAGGAGGACAGCGAAAATGTTAAAGAGGAGAAAGAGAAAAGCGATGCAGTATTTGAAGAAAATGTCAAATCAGAAGAGATTGAAAGTAAAGAGAAGACAGATGTTGAAAATTTAGTTAAAAAATTGGAAGTATGCGAGGATAACAACGAGGCTACTGTTGAAAAAGACGAAGATAGCAATAACGCAAAAGCCCTTGCTGAAACAGATGACACTTCCTCCAAAGTGCTCGAGAATGGAGGAAGTGATAACGCCGATGATGAGACTGTTAAGGAAGAATCAATTGAAACGAAAACATTGAGTGAAAATAACAAAGATGGTGAACAGAACAATAATGGGAAGGCTGATGAAGATGGAGGTGAAGAAGAGAAAAGTTCGGATTCGAATGACAACATGACAAATGAAACAGCTAAGCAGCGATGTGAAGGAGTACAAACGAAGATCAAGAAATCACAGCAACAATCCTACGAGTTTGGTGATGGCGACGACGATTACCTTCTTCACCTTGAAGACATTTTAAGCCGCATACACGAAGTGTTTTATCAAACTCTCTCGGATACCCAAAACAATCCGAGCGTCATTAAATACTGTTGCCCTGGAACCACAACACCGGATACGAAGGCGATAGTGACTGAACTACGTCTCGATGTATTGCGCGGGGCAAACGTCGTCTTCACGGGAGTGATTCCCACCTCTGCAAAACAGGAAGAAAGTCAGCCCTGGCGCATCGCGTGCGCCCTGGGCGCTAAAGTCAGCAACGCGATTGTCACACCCAAAGACACTAACTGTCACAGTGACGTCACCACTCACGTGATCGCAGGCAGGTTAGGCACGGAGAAATCATACCGGGCGGTAAAATCCCGGAGAATTAAACTCGTTAATCCAGGGTGGCTATTCTGCTGTTCTGAGCGCTGGGAGTGGGTTGACGAGCGGTTGTTTCCCGTGGAAGGCTTAGACAAGTACAAGCAACAGATTCGGGATCAAGGTACTCCTCGCGGGACACCTAAAGAAACTGCAGATACAACTGCGGTAGAAAACGCGTTGGACTTGGCTAATGTAGGTACGGAGGGCGTGTTTACCAAATCTAGATCTGATTCGGCAAGTAGCGCTGACCTACTTATGTCTACTTTAAATCCTTTATTGTCGTTTTCACCGTCCGAAGTGGAAGCAATGGACAAGGAGGTCGAAGACCTCATGAATGCCAGCGACGAAGAAAGTGATTTGATAGGAAGCGTGTCAGACTCTAGCTCATCAGATGAAGACGCTGAATCGAAAAGTAAACGAAAGCGAGACGAAGTTAAAGACTCGCAGGAGGACGATAATAAGAAAGGGCAGAGCAAGAAAATAAAGATTGATGGTGAAGATGAGGAAAAAGAGGAAACAGAAGAAACCGAAGAACAAGATTCAAGCAGCACCGATTCTGACGACTACACGCATCGTTCCACACCAAGTGATGATGATGATGATATGGCGGCCATGTTAGATGCGGAGTTGTCTCATTCATGA

Transcript

OS493_018701-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7TSG2	RNA polymerase II subunit A C-terminal domain phosphatase OS=Mus musculus OX=10090 GN=Ctdp1 PE=1 SV=1
Q9Y5B0	RNA polymerase II subunit A C-terminal domain phosphatase OS=Homo sapiens OX=9606 GN=CTDP1 PE=1 SV=3
Q95QG8	RNA polymerase II subunit A C-terminal domain phosphatase OS=Caenorhabditis elegans OX=6239 GN=fcp-1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006796 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00533 all species →	BRCT	BRCA1 C Terminus (BRCT) domain	Family	Interproscan
PF03031 all species →	NIF	NLI interacting factor-like phosphatase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004274 all species →	Domain	FCP1 homology domain	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR011053 all species →	Homologous_superfamily	Single hybrid motif	Interproscan
IPR039189 all species →	Family	CTD phosphatase Fcp1	Interproscan
IPR011947 all species →	Domain	FCP1-like phosphatase, phosphatase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23081 all species →	RNA POLYMERASE II CTD PHOSPHATASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008420 all species →	Molecular Function	RNA polymerase II CTD heptapeptide repeat phosphatase activity	Interproscan
GO:0070940 all species →	Biological Process	obsolete dephosphorylation of RNA polymerase II C-terminal domain	Interproscan
GO:0004721 all species →	Molecular Function	phosphoprotein phosphatase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15732	CTDP1, FCP1; RNA polymerase II subunit A C-terminal domain phosphatase	EC:3.1.3.16	Transcription machinery	ko03021	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018701-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

77.5Max TPM

13.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.00	15.88
polyp at pH7 6	18	18	9.16	17.59
coral polyp · control treatment	16	16	22.07	77.52
coral polyp · oil and dispersant treatment	16	16	17.31	74.73
coral polyp · oil treatment	16	16	17.79	62.89
coral polyp · dispersant treatment	16	16	10.51	35.33
Polyp	10	9	5.15	14.05

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.88
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.79
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.78
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.39
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.91
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.23
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.14
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.11
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.60
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.43
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.89
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.68
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.77
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.65
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.23
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.93
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.59
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.05
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.89
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.63
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.22
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.07
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.34
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.92
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.91
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.71
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.47
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.92
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.31
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.29
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.01
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.01
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.66
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.81
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	77.52
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.08
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.11
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.48
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.47
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.72
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.64
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.87
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.75
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.79
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.40
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.72
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.23
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.46
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.40
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.47
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.73
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.43
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.19
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.61
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.25
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.32
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.31
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.89
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.03
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.54
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.11
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.91
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.71
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.40
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.92
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.89
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.42
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.34
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.95
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.11
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.80
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.09
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.98
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.66
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.18
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.65
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.31
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.12
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.07
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.88
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.18
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.33
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.40
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.47
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.41
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.85
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.51
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.29
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.79
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.51
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.41
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.15
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.34
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.02
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.25
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.07
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.05
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.94
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.24
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.03
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.74
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.29
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.90
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.52
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.