Gene detail

Detailed information of OS493_018740-T1 in Lophelia pertusa

Genomic Location: scaffold_62:1785476...1817951
NR annotation: KAJ7385046.1, Transcription factor 25 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018740-T1

ATGTCCTCTCGCGTTTTGAGGAAGTTACAGGGCGATAAAGAATTTGAAATATCGCATGATGACGAGGAGGACGAAGATGAGTTAACCTTTACTTCAGCTAAGTCGAGAAGGAAACAGAAAGCCGTTGTAAATCCTTTTGATTTGTTGAATGTAGATGATGAGCAGTCAGATGAGGATTCTCAAGATAATCAAGAAGAAGAAACCCCAACAGAGGTTGTGGAACAAAATGTAAAAGAAGAGAAACCAAGTTCTATAGAGCCTGCTGAAAAACAGACATCTAAAAAGAAAAGAAAGAAAAAGAAGAAGAAGGGAAAAGGAGATACAGCAAAAGAAAATGGGAAACTAATTAATGAAGAGGACAGCATCGATGGTGTCATTGAAGAAGTGAACAACATGCCAAGGACTGATGGTCCAATGGCAACCTTGGGAGAGAGCACCTCTAGGATTCTGGATACAAAAGCTTTGCTTGGAGTAGAGCACAGAAACTTGAATGCAGAAAATGAAATGAAGAAGAGGTTTGGATCTCATATTGTCAGAGCAGAACAAAGACAAAGAAGAGCACATCAGCGGGTGTATCATCGCTCAACAAGGTTGGTTACAGTGAAGCCATCATGGCCACACATGGGAGCAACTGGAATAAGCATGAAGCTCTTGGAAACAAAACGTGGGTACAGCTACTTTGCCTTTGAACACTCCCCTTCTTATCAGGAAGTCCAGTTTCTATTTCTTGATGCAGTGGAATCATTAAACCCCAACAACATATCTGCCATTTTAAACACTCACCCTTACCATGTAGACTCTTTGCTGCAACTCAGTGAAATCTGTAAGATGGGAGAAGATTATCAAATGGCTGCAGAGTTAATAGAAAGAGCCCTCTATTGTTGTGAACAGAGTTTCCATACTTTGTTCAGCCTCACACAAGGCTGGTCAAGGCTTGACTACAGAAGGGCAGAAAACAGGTCATTCTTTATTGCTGTGTTTCGTCAAATCATCTTTGTGGGACAAAAAGGCTGCTACAGAACAGCTTTGGAGTTGTGCAAGCTCCTGCTTAGTCTAGATCCAGATGAAGATCCTCTTGGTGTTCTACTTATGATTGATTTCTATGCCTTACAGTCTGAGCAGTTCACTTTCCTCGTCAGACTATTTGAGGAATGGGAGTCCCACAGGAACTTGTCTCAGCTACCAAATTTTGCTTTCTCTGTGGCTCTCGCATACTTCCAATCCAACAGACAGCAGGGTCAGACAAGGAGAGCTGATGAATTGCTCCAGATGGCATTGATTATGTTTCCAATGGTATTGTCTCCTCTTATGGAAAAGTGTAATGTTGCGCTGGACACCACTCTCATCACGCACCCATTCTTTTCTCCTGTACCAGGAAACAGTGAGCCCATTGCTTTGAAGCAGCTTGAAGCACTGTACATAGGCAGGACATATCATGCGTGGAAAGATCCCGAGGTCATCGACTGGCTTGCCGTGAATGCTAAAAAAGTTATAGAAAGAGTTGAAGCACGAGATCCTTTAGTTGAAGATTGTAAATACAAGCGACAAGTGCGTTACAGAGGAACACCACGTAATGTTTACAGACACATAGTTATGTCAGATATTAAAGATGCCACCGCATCCCTTCCTATGCATTCTTATCCAGCACGGTTTGATTCTCAATTCTATTATTTTCTTTTAGGACTTGGCAATGTTCCTCTTTTGTCCTATGATCCTTTGCCACCTCAAGATTCAGTGACAGGATACATTCGCCAACCAAGGAGGAGTGTAACTCTTCAGGAAGAGCACGGAGCTTTGTCCATGTTTTTCCGCTCACTCTTGCCTTCCTTCAACGCCCAGAACCCTAACGGGCCGCGCGTGGAAGTAAGGCTTGAACAGCCCATAGAGCTAGAGGGAGCAGAGGGTGGACCCAGACCTCTGCGGGATACAGAGCTCGGGCGGGGCGTGGAAAACCTTATGGTCGCCATGAGAGAACTACTCACTACTCTCAGTTACCGTGGACAGCCTGAAGAGGCTGGTAACGAGGAAGGGGATAATGCTGGAGAAAATGATTATGCTGAAGATGAATGGGATTAA

Transcript

OS493_018740-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8R3L2	Ribosome quality control complex subunit TCF25 OS=Mus musculus OX=10090 GN=Tcf25 PE=1 SV=2
Q9BQ70	Ribosome quality control complex subunit TCF25 OS=Homo sapiens OX=9606 GN=TCF25 PE=1 SV=1
A0A8I6ASZ5	Ribosome quality control complex subunit TCF25 OS=Rattus norvegicus OX=10116 GN=Tcf25 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004418 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04910 all species →	Tcf25	Transcriptional repressor TCF25	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006994 all species →	Family	TCF25/Rqc1	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22684 all species →	NULP1-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:1990112 all species →	Cellular Component	RQC complex	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24970	TCF25, RQC1; transcription factor 25	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018740-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

29.6Max TPM

10.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.15	12.22
polyp at pH7 6	18	18	8.48	13.42
coral polyp · control treatment	16	16	15.16	29.56
coral polyp · oil and dispersant treatment	16	16	14.89	25.75
coral polyp · oil treatment	16	16	12.45	18.74
coral polyp · dispersant treatment	16	16	8.81	11.42
Polyp	10	10	8.05	13.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.22
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.45
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.56
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.52
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.47
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.43
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.75
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.71
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.71
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.82
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.32
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.23
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.52
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.67
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.60
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.59
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.57
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.48
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.42
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.26
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.91
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.35
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.34
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.28
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.94
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.94
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.94
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.90
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.88
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.32
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.25
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.02
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.33
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.24
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.39
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.93
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.56
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.49
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.35
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.04
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.82
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.77
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.78
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.30
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.20
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.76
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.93
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.78
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.41
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.89
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.70
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.74
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.75
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.00
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.23
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.57
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.70
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.04
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.94
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.38
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.91
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.35
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.23
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.63
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.41
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.03
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.19
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.90
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.74
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.50
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.19
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.89
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.42
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.71
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.65
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.54
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.59
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.58
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.52
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.34
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.05
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.46
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.42
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.07
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.29
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.81
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.70
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.63
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.60
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.29
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.93
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.56
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.19
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.24
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.99
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.75
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.99
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.48
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.50
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	9.03
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.15
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.06
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.91
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.89
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.69
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.87
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.96

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.