Gene detail

Detailed information of OS493_018870-T1 in Lophelia pertusa

Genomic Location: scaffold_63:1651476...1666260
NR annotation: KAJ7379074.1, Glutamate receptor ionotropic, NMDA 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018870-T1

ATGGATCGCGGACATCACTCTACATTTGTAAGATATTTGTTTTTGTTCGTCGCTTTCCTTTCTTGGTGCAATGGGAACACGGAATTCTTTGGAATCGGAGCAATGCTTTCCTCTCCAGACTACGAGAAAATCTTCGAAGAAGCCGTGGGCAAAATAAACGACAATTCAAGCGGTCTTCTAAGGACAACGAAGTTGAATGGAAGCTCTTACGTTTTGAGTACAAATCCCATTCGTTCAGCTCTGGATGTTTGCGAAAATTTGATCTCCAAAGGAGTAGGTACGGTTATAGTGAGTCACCCGAAGGATGAATTCTCTCCACCGATTTCAGTGTCGTATGCCTGTAGCTTCTATCATATTCCTGTCATTGGAATTTCCGCAAGAGAAACCATCTTCTCAGATAAGTCTATCCATGAGTTCTTTCTGCGTACCGTTCCTTCATACTCAGATCAAGCCTATGTTTGGCTGGGATTGTTGTATTACTTTAATTGGAGGAAGGTCATTCTGTTGACCAGCAATGACCAGGATAGTCGCATGATTGCCACTAGATTCACAGGTCTGGCCGAGAGAAATGACATCAAGATAGAGAAAACCATTATGTTCCCCACTGGATGTGTCAATGTTACGTCTCATCTGGCAAAGATGAAGAAATTACAATCAAGAGTTATTTCTCTTTATGAGGAAGATGCAGCAGTTGTGTATCAGAATGCTTCACATCTGAAGATGACTGGAGAGGGTTTTGTTTGGCTGATAACACAACAAAGCTTCTCTGGAACTGCTAGAAGTGTTTTGCCACAAGGTGTGATTGGGATGCAGTTACTTCCTGGCTATAATGAATCTGCTCAGATACAAGATGCTGTCAAACTCGTCGCAACAGCTCTTGACAGGCTGGTGACTGCTGGGAAGAGCTTAACTCCACCACCTGCCAGCTGCAGAGAGACTACACAGTGGGACAGTGGACAGACTTTGTTCAATGAACTCGTTAATACCACAGTCATCAATGGCAAGACAGGTGACATCACACTGAACAGAAAAGGTGATTGTATCAACACAGTTTATCAAATCGTCAACCTGAGGAAAAAGTCAGATGCTCAGCTAACAGTTGTTGGGGAGTATCGTGATTGGCAGGTGTCAATCACTGATACTATCACTTGGCCAGGAGGGCAAGATGAAACACCAGAAGGGATCTTTGTTTCTACTCATTTGAGGGTGGTGACACTGGTGGGTGAGCCGTTTGTATTCATCAAGTCTTTACCTGACAGCGGCAAGTGCGAAGATCTTGATGATCCTGAGAAGAAACGGAGGCACATCAAATGCTCTGGTAAAGTGTATGGTGAGCATGCTAAGGTGGTGGGTGCTGACAAGAATGATCATTGTTGTTATGGTTTCTGTATGGATCTGTTAAACAGATTGGGAGAGAAAGTCAATTTCACGTTTGATGTTCATTTGTCTGAGGATGGCAGCTATGGCTCTCTCAGGAGGGTAAATGGCACAGACATGAAGCGCTGGAATGGTATGGTAGGAGAAGTGATTGATGGTAAATCTGATCTCATTGTCGCTGCTCTGACCATCAACAATGAAAGAGCTGAATGGATTGAGTTTTCCAAACCCTTTAAGTACCAAGGACTCACAATACTTGTCAAGAAGGATCAAAGCAGAAACAGGCTGGACTCGTTCCTTCGACCTTTCCAGATAAACTTGTGGCTGCTTGTTTTACTCTCTGTCCACATAGTGGCAGTGATATTGTACCTGTTGGACCGGTTTAGCCCGTTTGGCCGGTTTAAACTGGCTCGGAAAGAAAAGGAGGAGACGGCTCTTAACTTGTCCAGTGCCATGTGGTTTTCATGGGGAGTACTGCTGAACAGTGGCATTGGAGAAGGCACTCCTCGCAGTTTCAGTGCCCGGGTGCTCGGCATGGTCTGGGCCGGGTTTGCCATGATTATCGTCGCCAGCTACACCGCCAACCTGGCTGCCTTTCTTGTTCTTGATCGACCAAAAGCTGTGGTCAGCGGTATCGATGATCCAAACCTTCGTAACCCATCAGTGAATTTCAAGTACGCTACGGTGGCCAACAGCAGTGTTGACGCGTATTTCAGGCGACAAGTCGAGCTGTCATCCATGTATACCTTCATGGAAAAATACAATGTCAAGACTGCTAAAGAAGCCATAAACAAAGTGAACAACGATGAATTGAAGGCGTTTATCTGGGATTCTCCTGTCCTGTATTATGAAGCTTCTGAAAACTGTCAACTCACTACCGCTGGCGAACTGTTTGGACGGTCGGGTTATGGCATTGGAATGCCTAAAGGTTCTCCGTGGAGTAATGAAATATCTCTTGCTATTCTGAACTTCCATGAGAGCGGTGTGATGGAAGAATTGGAAACCACGTGGATCGACACCAAGAAATGCGATGAACAGAGTAATTCACCCGCTACACTGGGGCTTAATCACATGCTGGGTGTGTTCATCATGGTTGCCGCTGGTATCGGAGCTGGGATCGTGATCATTATCCTAGAAATTCTGTACCACAAGCACCGTGGGTGGAAAGAAGAACAAAAAGAGCTGGCTAAAAAGACCACGGATAAATGGCGCGCTAACATCATGATGATGAAGAAGGATCGCACCAGAAATGGGCAACAGCCCAACGGTGTTATCGATTCACATTCCCCGCAGACTGACGGGATAGCTCGCAGGAACCCAATCTACAACCCCGAGAATCACGTGGACAGCACGTTCACGTATAATTAA

Transcript

OS493_018870-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0A1L8F5J9	Glutamate receptor ionotropic, NMDA 1 OS=Xenopus laevis OX=8355 GN=grin1 PE=1 SV=1
P35439	Glutamate receptor ionotropic, NMDA 1 OS=Rattus norvegicus OX=10116 GN=Grin1 PE=1 SV=1
P35438	Glutamate receptor ionotropic, NMDA 1 OS=Mus musculus OX=10090 GN=Grin1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000921 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10613 all species →	Lig_chan-Glu_bd	Ligated ion channel L-glutamate- and glycine-binding site	Domain	Interproscan
PF00497 all species →	SBP_bac_3	Bacterial extracellular solute-binding proteins, family 3	Domain	Interproscan
PF00060 all species →	Lig_chan	Ligand-gated ion channel	Family	Interproscan
PF01094 all species →	ANF_receptor	Receptor family ligand binding region	Family	Interproscan
PF10562 all species →	CaM_bdg_C0	Calmodulin-binding domain C0 of NMDA receptor NR1 subunit	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019594 all species →	Domain	Ionotropic glutamate receptor, L-glutamate and glycine-binding domain	Interproscan
IPR049872 all species →	Domain	Glutamate [NMDA] receptor subunit 1-like, ligand-binding domain	Interproscan
IPR049873 all species →	Domain	Glutamate [NMDA] receptor subunit 1-like, N-terminal LIVBP-like domain	Interproscan
IPR001638 all species →	Domain	Solute-binding protein family 3/N-terminal domain of MltF	Interproscan
IPR001320 all species →	Domain	Ionotropic glutamate receptor, C-terminal	Interproscan
IPR015683 all species →	Family	Ionotropic glutamate receptor	Interproscan
IPR001828 all species →	Domain	Receptor, ligand binding region	Interproscan
IPR001508 all species →	Family	Ionotropic glutamate receptor, metazoa	Interproscan
IPR018882 all species →	Domain	Calmodulin-binding domain C0, NMDA receptor, NR1 subunit	Interproscan
IPR028082 all species →	Homologous_superfamily	Periplasmic binding protein-like I	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18966 all species →	IONOTROPIC GLUTAMATE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0015276 all species →	Molecular Function	ligand-gated monoatomic ion channel activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0038023 all species →	Molecular Function	signaling receptor activity	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05208	GRIN1; glutamate receptor ionotropic, NMDA 1	-	Ion channels	ko04040	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018870-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

63.7Max TPM

17.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.05	20.91
polyp at pH7 6	18	18	11.23	17.46
coral polyp · control treatment	16	16	21.67	35.77
coral polyp · oil and dispersant treatment	16	16	29.29	63.72
coral polyp · oil treatment	16	16	17.75	30.05
coral polyp · dispersant treatment	16	16	19.98	43.53
Polyp	10	10	8.03	13.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.91
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.85
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.21
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.18
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.00
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.36
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.30
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.78
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.75
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.51
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.16
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.63
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.60
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.41
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.30
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.28
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.06
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.67
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.46
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.56
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.07
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.89
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.78
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.87
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.80
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.50
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.89
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.93
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.69
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.35
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.79
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.58
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.34
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.94
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.78
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.96
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.77
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.57
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.60
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.81
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.20
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.63
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.81
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.90
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.71
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.41
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.83
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.68
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.05
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.94
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.42
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.43
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.72
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.93
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.84
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.45
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.17
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.57
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.20
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.84
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.79
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.31
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.07
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.73
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.97
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.63
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.93
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.05
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.89
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.68
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.63
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.45
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.02
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.86
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.31
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.10
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.91
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.79
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.88
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.13
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.77
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.71
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.79
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.53
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.69
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.18
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.08
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.36
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.35
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.10
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.09
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.37
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.37
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.12
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.71
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.46
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.36
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.98
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.89
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.48
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.72
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.45
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.96
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.29
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.27
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.45
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.74
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.04
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.88

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.