Gene detail

Detailed information of OS493_018936-T1 in Lophelia pertusa

Genomic Location: scaffold_64:303111...314112
NR annotation: KAJ7372433.1, 1,4-alpha-glucan branching enzyme [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_018936-T1

ATGAGGCGAACAAAGGCTCAGAGAATGTATAACTTACACGTTTTTGGTGCTCAAAAGATGGCAGATGACCAAATAGTTCCACGGTTTTCCAGATTTCTTAACGATGATCCTTATATTAAACCATATCAAACAGAGATAGAGAGAAGGTACAAGGTTTTTACTAATCTTAAGAATGAAATTGAGAAAAATGAAGGAGGCTTAGAGAAGTTCACCAGAGGTTATGAGAGATTTGGAATCAACAGGACCCATGAGGGTTTGACATACCGTGAATGGGCACCAGCCGCTCATGGAGTGTATCTTACAGGAGACTTCAATGGCTGGTCCAGAACTTCTCATTCATGTACCAGGAATGAGTTTGGGATCTGGGAACTAACCTTACCTTATAAGGAGGATGGCTCATCACCAATCCCCCATGGGTCAAAAGTTAAGGTTTCAATCCAGCTTGAGAATGGTGATCTAGTTGACCGTATTTCACCGTGGATCCGTTATGCTGTCTGCCCTGAAGACAATATTCTGTATGAAGGAATCCACTGGGACCCACCACAGCCTTACCAATGGCAGCACAGTCCACCCAAGAAAACCTCAGGCCTGCGAATTTACGAGTCTCACGTCGGCATAGCCTCCTCAGAGCCAAGAGTTGCTAGTTACAAGCATTTTGCTCATAGTGTCATTCCAAGGATAAAGAAGTTAGGATATAATTGCATCCAGCTCATGGCTGTCATGGAACATGCTTACTACGCATGCTTTGGTTACCAGGTTACAAACTTCTTTGCAGCCTCCAGTCGTTATGGAACACCCGAGGATTTGAAAGAACTGATAGACGTGGCTCATGCCAATGGGATATTAGTCTTACTGGATATGGTACACAGTCATGCCGCCAAAAATGTCATGGATGGATTGAATGAATTTGATGGATCACAAAGCTGTTATTTCCACGGTGGTGGACGTGGAACTCATTCGCTCTGGGACAGCCGACTGTTTGACTATACTCAGTGGGAAGTTCTACGATTCCTTCTGTCCAATCTGCGCTGGTACATGGAGTATTATAAATTTGATGGCTTCCGATTTGACGGTGTGACGTCAATGATATATCATGACCATGGGCTTGGACACGGCTTCGGTGGAGACTATCCGGATTATTATGGACTTGGAGTAGATACGGATTCACTTAACTACCTCATGTTAGCCAATGACATGTTGCATTCTATATATCCAAATGTCATCACTGTTGCCGAGGAAGTATCAGGAATGCCGGGCTTGTGTCGTCCAATCACTGAAGGAGGATTAGGGTTTGATTATCGTCTTGGAATGGCCATACCTGACAGATGGATCAAGGTTCTCAAAGAGGTTAAAGACGAGGACTGGCGGATGTGGGACATTGTGTGGACCCTCATTAACCGCCGCCATAACGAGAAAACCATCGCGTACGCAGAGTCTCATGACCAGGCCCTTGTCGGCGACAAGACGATTGCATTCTGGTTGATGGACAAGGAGATGTACACGAATATGTCAGACACGACACAACTGACCCACATTATTGACAGAGGAATAGCGCTACACAAGATAATCAGGCTCATATCGTGTGGTCTGGGAGGGGAAGGCTACCTGAATTTCATTGGAAATGAATTTGGACACCCGGAATGGCTGGACTTCCCACGAGAAGGAAACCAGAACAGCTATCACTATGCGCGGCGACAGTTTAATCTTGTGGACGATCAGTTGCTAAGATACAGGTATCTAAACGAGTTTGACCGGGCCATGATGCATCTTGAGGAGAAATACCATTGGTTGGAGTCGCCCCAGGCCCATGTAAGCTGTCACCATGAAGATGACAAAATCATTGTATTTGAACGAGCCTCGTTACTGTGGGTGTTCAACTTTCATTCAACCAAGAGTTTTCCTGACTACAGAATCGGTGCTAGCATCGCTGGAAAATACAGAGTAGCTTTGGAGACAGATGCCGCTGAGTACGGCGGGCACAAGCGGCTGGATTCAAACTGTGAATACTTGGTAGACAGTCAACCATGGCACGACAGACCATTTTCTCTTTTGGTGTACGTACCATGCCGTACCGCTCTGGTTTTAGCACCGGTATAA

Transcript

OS493_018936-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q04446	1,4-alpha-glucan-branching enzyme OS=Homo sapiens OX=9606 GN=GBE1 PE=1 SV=3
Q9D6Y9	1,4-alpha-glucan-branching enzyme OS=Mus musculus OX=10090 GN=Gbe1 PE=1 SV=1
Q6T308	1,4-alpha-glucan-branching enzyme OS=Felis catus OX=9685 GN=GBE1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003447 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00128 all species →	Alpha-amylase	Alpha amylase, catalytic domain	Domain	Interproscan
PF02806 all species →	Alpha-amylase_C	Alpha amylase, C-terminal all-beta domain	Domain	Interproscan
PF02922 all species →	CBM_48	Carbohydrate-binding module 48 (Isoamylase N-terminal domain)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006047 all species →	Domain	Glycosyl hydrolase, family 13, catalytic domain	Interproscan
IPR014756 all species →	Homologous_superfamily	Immunoglobulin E-set	Interproscan
IPR006048 all species →	Domain	Alpha-amylase/branching enzyme, C-terminal all beta	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan
IPR037439 all species →	Family	1,4-alpha-glucan-branching enzyme	Interproscan
IPR013780 all species →	Homologous_superfamily	Glycosyl hydrolase, all-beta	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR004193 all species →	Domain	Glycoside hydrolase, family 13, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43651 all species →	1,4-ALPHA-GLUCAN-BRANCHING ENZYME	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0043169 all species →	Molecular Function	cation binding	Interproscan
GO:0003844 all species →	Molecular Function	1,4-alpha-glucan branching enzyme activity	Interproscan
GO:0005978 all species →	Biological Process	glycogen biosynthetic process	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00700	GBE1, glgB; 1,4-alpha-glucan branching enzyme	EC:2.4.1.18	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_018936-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

43.3Max TPM

18.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.50	26.00
polyp at pH7 6	18	18	19.88	31.11
coral polyp · control treatment	16	16	21.94	34.34
coral polyp · oil and dispersant treatment	16	16	20.32	41.60
coral polyp · oil treatment	16	16	18.96	43.25
coral polyp · dispersant treatment	16	16	17.37	29.77
Polyp	10	10	12.23	26.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.07
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.49
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.79
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.62
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.05
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.74
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.27
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.01
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.95
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.33
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.80
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.77
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.60
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.00
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.96
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.78
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.83
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.56
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.89
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.92
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.40
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.24
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.13
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.87
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.74
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.69
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.49
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.07
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.36
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.15
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.74
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.95
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.46
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.34
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.23
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.97
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.80
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.44
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.80
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.72
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.69
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.43
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.27
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.52
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.88
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.29
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.03
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.60
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.69
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.17
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.49
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.68
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.51
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.84
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.13
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.61
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.02
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.80
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.46
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.02
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.11
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.82
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.25
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.64
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.22
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.18
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.36
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.71
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.09
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.96
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.43
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.38
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.03
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.59
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.37
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.25
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.50
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.77
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.68
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.52
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.94
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.87
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.55
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.98
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.55
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.06
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.57
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.08
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.12
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.34
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.46
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.27
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	26.69
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	18.82
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	12.26
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.22
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.97
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.86
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.38
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.30
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.28
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.54

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.