Gene detail

Detailed information of OS493_019148-T1 in Lophelia pertusa

Genomic Location: scaffold_65:1802462...1813929
NR annotation: KAJ7360057.1, identical protein binding [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_019148-T1

ATGACTGGTTTGGTTAAGAACCAAATCGCGAAGCAACTGGCGAGGTTCACAAAGAATCTCTCTCCCAACAAAATCAGCGTGAAGTTTCTCAAGGGAGAAGGGGAGCTTCATAACCTAGAGCTAAATGAAACAACATTGTCTGAACTTCTTGAACTGCCACCTTGGATTCGTCTCACGAAAGCTGTGTGCAACAAGATTTCCGCCAAGATTCACTGGACACGACTCAAAACAGACCCAATTTGCCTGTACCTTGACCGTGTTGAAATCAATATGGAGGCAATAGATGGTGATGTTAACACCCCACCCCCTGGGTCACCCCAGACACACCCGTCTAATGCACCCCAACAACCAGCCAAGGAGAAAGCTCCTAATAGGTACGGTTTTGTTGAGAAAGTGGTTGATGGAATGTTTGTTCAGATCAACTCTGTCATCATCTCGTTCAAGTTTCAAGCTTTCCTTGCCACGTTCCAGATGTCGCGTCTTCTTATTCAAAGTACAACTCCCAACTGGCAGCCAGATGATCTGCGCATGACACGGGTGAAAGACGAGACGAGAGGAGAAGTGCTGACATTTAAAGAAATAACTTGGCAAACACTTAGGATAGATGCTAATGCTTTATACAATGAAACATCAAAGCAACAGTCGGCTCCTCTGCGTCTTATAACAAGCCACTCAGCACTACACATAACAATCAAAAAACGTCTTGAAGACTGTGCCGTGTTATCTGCAAGACTGGAACTTCTCTTAGATGATATTTTATGGGTTCTTACTCAGTCACAGTTAGAAGCTTTAGCTGGACTATTGCACTCTGTGACCCAGGCCATGTCACAGACAGAAGCTAAGAAGGGGCCTGAAACCAATCCTGGGCAACCTGCTGGCCAGGTTACCCAGCAGCAAACGCATTATGCAGCATCTACGATTCACGAACGAAAGACTGACTACGAGTCTTTAAATGCACTCTTTACGCAACATGATGTGCGGGAAACATCTTATCATGTAAGGACAGGTAGTATTGACCTGCACTTGTGCGACGATTCTGAAGAAAAGGCCGGTGATGGCGGAGCTATGCACTTGCAAATGAACAAGTTATCAGTTGATTACTATCCATATCACTTGGCTGGAACATCGCGAACTGATTGGCCGTCCCATAATGAAGCATCCTTGACCCGTGCGTACTGGGTCAGTCAGCTTTTGAATGCATTTAGGAACTCTCAAAGGAACAAACAGTTATCACCTCAAAGAGCAGCGCAGACTCATCACCGAGCCAGAAGTGATAGTTCTCTTATTGGTGTCAATGGTAGAGAAGGTACGCCACATCCTTCTTCTCCACTCCTCAGTACTCCTTCCTCTCCTCGCTTGAATTCCAAGAGACCAAACCCTTCAAGTCCAGGGGCATATTCCCGAGCTGGACAATCGGCTCATTCCATCAAGAACAGCTTGGCACAGCGTCCGGTGTTTATGCTGGAAAGCTGTTTTGTGATTCGCTGCGAGGAATTCTTCATCCTGCCTGTGACAACTACAGGTAGTAACATTTCGAAGGAAGAATCAACAGCATTTTTATCATCTGATAAAAAAGCATTATACCTACCTTCAGACATGCCAGCTTTTCAGTTGGACTTCACACAGTATTACTACCCTGGATCTATAGGGTCTGCAGTGCCTTCTCCAAACCTGTTTATCCAGTTAAACCCGATTCAGTTGACACTAGACATTGCAACTTGTCTGTGGTTCAACAACTTCATGCGAAGCATTCTTGGACAAAGAACATGGTCCATGGGCTCACCCCAACAATCTAATCAACCCTCAAGTCATATTGACATCAGAATCGAAGCCCTTATGCCAAAGATAATTATTCCTTGCCCAAGTGAACCTTGTGCAGCGTATAAAGATTCTCGGCCCCAGGCCCTCCAGTTACAAGTATCCCAAGTGTTTATCACAAATTCAAGGACTGGGTACAAGTCCACCCAGACAGACATGTTGATGTTTCTTCAGCCTTTCCTGGGCTCCAAAGTTTACACGGATTTTGAAAACTTCCCAGCCATGCTTGGTGATGTACAACCTTTGCCCAACTCTTCATGGGTGAATGACTGTAGTGTGTTGGCAAACTCGAAGATTGATAAACATTTGAATGGTGTTTGTCATGATGCCTTTGGAACACATCAGCCGTCACAGGTTTGGTGTATTTCAGCTGAGCAAGTGTGGCTTGACTTTCTGGGTATTGAGGAGGTCAAGAACAGACCCATGCCTTTTATAGATGCTGTTCCTATTCAGATATGGATTGCCACTCCCTTGCCAACCCAAGACGACGACAGTACAGCCATTCATTCAGCAGTGCGAAGAACCCAAAGCACCAGCCGGCTGCACTCACCACCACACGGGAGGTCATCTTCGGAAATCTTCTCCCCAAAGAGAAAGGCTTCTGAACCAGTGATATCTGTGAGGAGCAGAGCAAATACGGCCACTCCATCACTCTTGTCTACAACTCCAAATGGCTTATGCAATAGTGATCCTAATATGAGCCCCAACCCTCCTGAGGACCTTACTAGTGTGAGCCCGGTTCTAGATGGACCACCACCAGCTTATGAGCCCAGCGATGACTCGCACAAGTCAGTCCCTGTTGTGAGTGAACCACCCCCACCTTACGAGACATTGATCCATAATGGGCCTAATTTATCAGGGGCGCCCTTAGAAGAAGCTCCGTCATTACCAGAGAAGGCCCCTTTATCTGAGGGTACGCTGAATGGCCTGTCAGAAACAGAGGGACGTTCAAGTCAGGAGCTCGATTCAGGGACAAAAGCCGATGTGAGCTTCCTAATCCATATCCCACAATGTGCTAGCATGCAGTTGGACCACTTTCAATTCATCTTCCTTTTGCGTCTACAAGAGATGTTAATTAAGCTACAAGAAGATTTAGAAAAGGACAAATTAACACAGAGTAACGATGTCTCTGAGTTGAATGAGTCCGGAGATGCTCAGCCTTCTGTGTTTTTTTCTATTCTTGCACGTGGAGTGGACGTCAATATTGTGCTTCCTCCAGCCCCCGACAATCATGATGATGTATCTCGTATGGAGACGGATCCTTCTCAAAATACCAGCCGCAACGCCAGTAGTCTAAGCAGCTATCTAGACACTGGTGGTGTGTTGGATAGTGGTTGCCAGTCTCCCGACGTTATTGATTTCAAGACACCCTCCAGAACAGACTCAGAGGAGGCTGCTCCGCATAAAGATGGATCGGTGTCCTGTGAGACTCGCCCCAGCTCGGCGCAGTCGGCGAGTCATACGTCAGGGCGTGCCAGTGTAGCTTCAGCACCGGATTCTGATGGCTGGCTGGTGGTGCCACCCGGTGACAAGTCCACGTCTGACCGCGTACAGAGTAGGACAGATAGCAATGCGAGTAACTTCAGCAGTCAATTGGACAGTAAAGATTCCAGCAGCAAGGACGTTGAAAAGGAACGTAAAGACCCCAAAATGGTGTCGATTCTCTCCATCGAAGGAGAGGAAGTGGAAATTGGAATCCATCTCCAAGGATATGACAAAGTTATCAAGATAGTTTGCCCGGAGCTCAAATTGGAAGAGCTTGGTGTGATCAATTTTGAAAAATACCTTAACCAAAAGTCCTTTAGAAAGTCACTCGCTGCGAAAACTGCGGTCCCTTCTACGTCAGAGGGTCCTTCCATGGCTTGTATTCGCGTCGAGTTTGGGCCATCTGCAGAGAGGTACGAGTCGACAGCCGGTGAGAGGGGCTTCATGCATGCTAAAGTGAATGGTGTTAACAGTGCTCTGCTAATGAGTACCCTCGGAAGCATGGCCGAGTGCTTTGAAGACGAAGTGTTGCTTCCTCCAATGCCTTTCTTAGTAGAAGTAAACAACTCGCGTGTGAGTATCAATAACGATCTTCCTCCTACCTTAGTGTCTGCACCCTTGCCCATTCCAGTGGATTTAAGCGTTGAGAACATCTCAATTCGTCGGGCGCACGATGGCGTTTTTCACATCAAGCCATTAAGCGGCGACGACTCACAAGCGCGCGAAAGTGAACAGCCAATCACACGCCAGGAGTCGATCAATGCAAGTCAGCTGAGCCTGTCTGATTCAGCCTCGGTGTGTTCCCGGGCCGAGAGTTTGGAGAACGAGAAGCAGTGCCTGGTTGCGCAGATGGCGGTTTCCCGTGCTACAATGCAGTCGCTACAGGAGGAGCGCGATGCATTGTTGAAAACAATCGAAAGGCTGCAACAGGAGTTGTCATTTTCGAACCGCGAACAGGACTTGTTACAAGAGAGGATGACTAGCTTTCAAAAAGGAGGAAGGAGGGGCCACAGATAG

Transcript

OS493_019148-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6NRZ1	Bridge-like lipid transfer protein family member 3B OS=Xenopus laevis OX=8355 GN=bltp3b PE=2 SV=1
Q6BDS2	Bridge-like lipid transfer protein family member 3A OS=Homo sapiens OX=9606 GN=BLTP3A PE=1 SV=1
A2RSJ4	Bridge-like lipid transfer protein family member 3B OS=Mus musculus OX=10090 GN=Bltp3b PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005606 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12624 all species →	Chorein_N	VPS13-like, N-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR026854 all species →	Domain	Vacuolar protein sorting-associated protein 13-like, N-terminal domain	Interproscan
IPR026728 all species →	Family	Bridge-like lipid transfer protein family member 3A/B	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22774 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_019148-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_019148-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_019148-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

45.0Max TPM

16.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	10.74	15.06
polyp at pH7 6	18	18	10.24	14.58
coral polyp · control treatment	16	16	18.58	26.36
coral polyp · oil and dispersant treatment	16	16	25.50	37.41
coral polyp · oil treatment	16	16	15.65	23.15
coral polyp · dispersant treatment	16	16	22.94	44.98
Polyp	10	10	5.61	8.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.06
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.29
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.21
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.21
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.48
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.32
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.85
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.28
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.91
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.18
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.79
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.53
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.49
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.48
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.13
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.23
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.58
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.43
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.22
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.76
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.46
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.21
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.08
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.93
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.18
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.84
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.81
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.26
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.31
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.22
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.91
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.14
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.98
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.36
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.39
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.12
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.34
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.64
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.42
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.48
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.38
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.74
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.43
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.07
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.38
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.76
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.40
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.20
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.13
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.41
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.60
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.26
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.78
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.63
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.44
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.25
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.28
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.50
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.28
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.78
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.04
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.93
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.77
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.15
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.47
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.43
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.65
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.51
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.32
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.19
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.39
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.13
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.09
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.84
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.20
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.19
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.35
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.17
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.31
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.98
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.37
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.12
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.24
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.23
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.05
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.35
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.81
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.15
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.24
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.07
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.73
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.53
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.98
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.96
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.20
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.52
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.01
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.44
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.35
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.97
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.25
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.21
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.82
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.76
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.76

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.