Gene detail

Detailed information of OS493_019157-T1 in Lophelia pertusa

Genomic Location: scaffold_65:1943053...1968787
NR annotation: KAJ7360065.1, Liprin-alpha-1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_019157-T1

ATGATGTGCGATATAATGCCTACGATCTCTGAGGACCCACCAGAGATCCATTATGGGCAAAATGAGGAAACGAACTTCGAGCAACTTATGGTTAATATGCTGGACGAACGGGACAAGCTTATGGAAACTCTTCGCGAAACTCAAGATTCGCTTGCGCTTACAAGAGCAAAGTTAACAGAATGCCAAAAGGAGAAAGATGGTCTCATGAGTCACTTGGAGTCTGTACTTAATGATGGTGATGATCAACTAATTGAAAGGCTAGCTGGTTTGGATGGAATTATTACCGAGTCAGGCAATAATTTAAAAGAAGACTCCGGCAAGAATCGTGTTCAAGTTTTAGCAGAGGACTTTGCGACAATGCTAAAAGAACTAAACCAAGCTAGGGAACAGCTTTTAGAAAAAGATGAGGAAATCAGTGAACTGAAGTCAGAGAGGTGTAATACAAGACTTCTTCTAGAACATTTAGAATGTTTAGTAGCACGACATGAAAGATCCTTAAGAATGACAGTTGTCAAACGACAAGCCGCCACTACTGGAGGTGTATCGTCAGAAGTGGAAGTTCTTAAGGCTTTAAAATCCCTTTTTGAACACCACAAGGCTTTGGATGAAAAGGTGCGTGAAAGACTGCGACAAGCTGTAGACAAGAACAATGCACTTGACGCAGAACTTGAAGAAACTCGGGAAAAGCTCAAAGAGCTTGAACAGGAAAATGAGGATATCCGACTTCGGAATCTTAGAAGAGTGAGAACCGAAGAAAAACTTCACACATCAAGCGAAAACTGTGTAGAAAATGGTGATGAAAATTCTAACGGAGAAAAGCATCTTTCTAATGGACCCGTTAATCTTGAAGTGAGTGTACATGAAGAACAAATGGAAGAGATGCAGTTTCTTCTGGACAAACGAACAAAGGAGGTTGAACGGCTCACCAGAGAAAACAAGGACTTGAAAGAGAGATGTACAACACTTGAAGAAGAATTAAGAATATGTAATAAACAGCTTGACAGAGGAAATACTTCCATTCAGAGATTGGAAAGAGATTTAGATGAGGCGGCAGCACAGAAATCAGATATGGAGGATAGAATAACAACTCTTGAGAAACGTTATGTGCGACTTCAGCATGAAGTCACTGCACTGAATGATGATAATGAGAGACTGGAAACTGAGCTTGCTAGCAAAGAAAGTGAACTTATCCAGACGGAAGAAAAATTAAGGTGTCAACAAGAAAAACTTGAACTCGCCGAGCAGAACCTTAACCAGTCTTTAAGAAAAGCTGAAGCATTACCCAAAATAGAAGAAGAATTGGCTGTACAAATGGCAGCCTTAAATGAGGCTGCAGAGAAACAAGGCTCAGCAGAAGAGAATGTTCAGCAGCTACAGATCCAGGTTCATGACCTTCAAGCTGAGGTTAACAGGGCACGTGAAAGAGAAAAGATGAACGAAGATCATAACACTAGATTATCAAATACGATTGATAAACTGTTGGGTGAGTCAAATGAAAGATTACAAGTACACCTGAAGGAACGAATGGCTGCACTGGAGGAGAAGACTGCTTTGGCGCAAGAACTTACATCAGTAAAATCACAAATAGAAGATCTTCAAAGAGAAAAGGAAATATTAGCTCTAGAACTAGGACGACTTCATGAAGAATTTGGAAGACGCAAATCTAAGGGTACTCCTTCTGCTGCAGTTAATGGCCCTGTTGTGCACTTTAGCAGTGAGCCTGTTAGACGAGAGACAAAAGGTCGCTCTGGAATTGAGGAATCGCCCAGCAGGGTTTTCACACTCAATGAACAGGAGTGGCAGAAGCTGGAACAAGAAAGCGTTCTTAAAAATGTGGCCATGGCATTTGACACAGTCGGCAGTCAGCTGTCTGACATTGAAAGTGATGCTGGTAGTGACATTTCTGAGGAAAAGAGCGTGGGCGGCGATGCACAGACACTAGCATCCCTGCTACAACAGCAGATAGACGTTATCAACAAAGAGCTCAACCAATTACAAGAGGAACACAAGTCGACAGAGAAGAGAGCTATTGTACTGGAAAGGACCACAACAGGAAGCCCAATGCATCAAGATGTTTATTCAGCTGATTCTCAACAGGAGCTGGTTGCATCTTCTACATCCTTCCCTTTTCCTCCTCTTGACCCCATGGATACTACGCCCATCTGGGTTAAGTCAAGCAAGGAAGGTTCACTGAACACACTTGATGATGCACCCACCCCTCCCACGCCTAGTTCAGGTACATCTGATTCAACGGAGAGTTCTAAACCCAGTCAAACGGGTGCACAGTCCAATTCATCGCCTGATGACATAGCGAGTACAGTTCCGTCTACTAATGGCATGATCAAATTAAGGGATAATTCAGTGGACTCCTTACCAAGTGTCACCAGCACAACAAGTAGTGCCGAATCTTTATCCAAGAACAACTCGCGCAAGAAAGGCATCAAAGGGTCGTTTGGACGTCTTTTTGGAAATAAAACAAAGACTAAAAATAAGGACTCTGAGGGTGTCCTAACAGACTCTTATTCACTTCCTAATGAATCTGTTCCAAGTGGTACAGGACAAAGAGAGTTAGATAGAAGAATAAAAAATAAGTCACATTTGTTAGCAGAAGCATTAGCGGCTGGGACACCTTTTGCTTTGTGGAATGCACCTACAGTTGTGGCTTGGTTAGAGTTGTGGGTTGGTATGCCTGCCTGGTATGTTGCTGCCTGCAAAGCAAATGTTAAGAGCGGAGCAATCATGTCGGCTTTGTCAGATACTGAGATTCAACATGAGATTGGCATATCAAATCCACTTCATCGGCTCAAGTTACGACTTGCCATTCAAGAGATCGTCAATCTTACAAGTCCATCCTCACCCACAACCAACAGAAATTCGTTAGTTTATGGTGAAATGAATCATGACTGGATTGGTAATGAATGGCTTCCAAGTCTAGGACTCTCTCAGTACAAGAGCACTTTTCAAGAATGTTTAGTAGATGCAAGAATGCTGGAACACATAAGCAAGAAAGAACATCAAAAGTACTTGAAAGTAGTAGATGGTTTTCACAGGCACAGTTTACAATGTGGTGTCAAATGTTTAGGATTTATGAATTATGATAGAAGGTTGCTGGAGAAAAGAAGGCAAATGTGTGCTGACGAGGTTAAAGATGTACTTGTTTGGAGCAATGAGCGTATAATTGAGTGGTTAAGGAAGATTGGATTGAGTGAGTATGCTGATAACCTGAGTGGTACAGGAGTACATGGAGCAGTGATTGCGCTGGATGATACATTCGACTTCAGTACTATGGTATACGCTTTACAGATACCCAGTCAAAACACACAGATTCGTCAAATTCTTGAGCGGGAATTCAACTGGCTGCTGGCGAATGCTACTGACAGAGAAGTCGTAGATGAGCTTGGTAATGGTGGTGATTTCAAACGCACCAAATCGTGGCGAAAGATGTTTAAGCAGCGCGATAAAGGAAAGGACAAGAACAAGGACAAGGAAGCTAATATGAGAAAAAACTCATCGGGATCCGAGTCATCTCTGAGTCAGTCAAGTGTGAGCTCATCTCCAAAGCCTGCAGCTAAGAATGCCAAAAACAACTTAGTCAGTGGCAGCGACACAAAAACATCAGGTGGTGGTTCAATGATCACAAGTAACAGCCTCTCATAG

Transcript

OS493_019157-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13136	Liprin-alpha-1 OS=Homo sapiens OX=9606 GN=PPFIA1 PE=1 SV=1
O75334	Liprin-alpha-2 OS=Homo sapiens OX=9606 GN=PPFIA2 PE=1 SV=2
Q8BSS9	Liprin-alpha-2 OS=Mus musculus OX=10090 GN=Ppfia2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003627 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07647 all species →	SAM_2	SAM domain (Sterile alpha motif)	Domain	Interproscan
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR037620 all species →	Domain	Liprin-alpha, SAM domain repeat 1	Interproscan
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR037622 all species →	Domain	Liprin-alpha, SAM domain repeat 3	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR029515 all species →	Family	LAR-interacting protein, Liprin	Interproscan
IPR037621 all species →	Domain	Liprin-alpha, SAM domain repeat 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12587 all species →	LAR INTERACTING PROTEIN LIP -RELATED PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0048786 all species →	Cellular Component	presynaptic active zone	Interproscan
GO:0050808 all species →	Biological Process	synapse organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26226	PPFIA; liprin-alpha	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_019157-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

33.5Max TPM

11.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.25	24.49
polyp at pH7 6	18	18	14.71	33.54
coral polyp · control treatment	16	16	14.27	24.48
coral polyp · oil and dispersant treatment	16	16	10.13	19.80
coral polyp · oil treatment	16	16	10.35	17.45
coral polyp · dispersant treatment	16	16	10.21	18.16
Polyp	10	10	4.87	8.40

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.49
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.99
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.20
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.75
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.76
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.63
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.71
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.14
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.22
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.77
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.68
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.27
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.03
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.65
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.49
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.78
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.94
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.67
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.75
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.21
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.95
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.69
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.49
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.20
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.90
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.97
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.15
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.26
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.48
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.38
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.48
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.21
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.20
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.25
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.21
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.18
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.60
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.86
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.92
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.66
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.51
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.66
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.77
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.35
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.65
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.80
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.82
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.97
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.74
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.39
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.61
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.83
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.11
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.07
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.99
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.79
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.76
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.43
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.16
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.32
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.45
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.88
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.65
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.38
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.16
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.61
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.56
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.30
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.18
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.31
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.13
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.18
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.69
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.96
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.26
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.96
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.16
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.38
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.48
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.20
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.93
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.67
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.68
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.42
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.06
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.81
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.80
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.15
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.36
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.14
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.40
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.64
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.40
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.93
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.89
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.15
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.80
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.67
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.44
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.77
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.54
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.14

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.