Gene detail

Detailed information of OS493_019459-T1 in Lophelia pertusa

Genomic Location: scaffold_67:1795885...1812178
NR annotation: KAJ7391326.1, C2 domain-containing protein 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_019459-T1

ATGTTCTGGTGTGAAGAGGTGTCTAAATCAAGGGTTTGTTGGGGAGCTACGAACCCACCATTTGGCTTTAAACAGGTTGCCCCAGTGCGGCTCACCTCAACTCTGCTACAGCGAGTCTGCAATAACTTCATGGTTGTCGAGGTTTGGAACAGGATTGGGCCACATGACCAGGGAGACAAGTTGTTAGGACTAGTCAAGTTACCACTACACCAACTGTACTTGTCATACAGGGACCCCAAGATCACTAGAACACTGCTCAAGTCAAAGTATCCTGTAGTAGCAGTGGACCAGTGGTGTCCTGTGACCAATCCATTCACTCATGTGCAGCATGGTCATCTAAGGGTCCTTTTAGCTATGGGTTTGGAGGAGCAGATTGGAGCCATTTTAACAATGAAGTGTGGAGGAGAAGTTCCGATTGGAATAGAGTCACGCCCAGATCATCATCTTGATTCACAGAGAGTGAGAAATGAAAAAGAAAGTGAAGGTGTCCCTTTGTCAAGCAATCAAGAATTTGTTGAACACCAGTTTGAGGTTGTGGTTGAGGACATCAGAGGTTTGTCAGTGTTTGGTAGCACTGTCTGGGGTGAAACTGACTGTTTTGTCCAGTATCACTTCCCATTCCAAAGGCACCTGGAATCTGACACGCAAAGCAAAGGAATTCCCCACCTTCAACCTCACCGTACCCCCACCACGCTGTGTGTGCCTGAGCCAGCATTTCATGATGTGGCAAGACACACGTTCAAGCTTCCTCAAGGATTTCCAGTTCAGAAACACTTACTGGCAGCATTCACTGGTTCATGGGTGGCTGCTCCTTGTGTCCCAGGGTCTGGTGGAGTTCCTTTTGAACTGTGGAGGAGATACTACTACCCAAACATTAGAGACCAAATGGTGGCTAAGGCAAATCTTCCACTTGCTAAGCTGTGTGCAATGGTAACCATGCAGAAACAGGGCGAAGCCAATATCCAGACCTTCTCCTTGCCACTGACAGTCCTTGCTGGAGATGAGATGGATGGTATGCGACAGGACAGAGTACAAGACACTGGGCTGCTTGATGTCACTGTTAAGTATCAGCAAGTGAAAACAGGGCAACCAGCAGGAGGACACACAGCACAGGATGACAACCATGTGTGTTTATCACTTGAAGTGTTCCAGGCTTGTGGACTTAAGGCAGCAGCACGTCTTCATTCCAAATCCAAGCCCAGCCTGTCATATCCTGCAGAGGTTGGTGTTAATACATACATAGTGATACAGTTACCACTGGGAAAGAAGCACAAGCATGTGACAAGAACTGTAGCACGGACATTCAGCCCTGAGTTTTCATATCATGCAGACATCTTGTTACCAGTAGTGGTACCATCTGGTGTGAGTGGTAAAGGAAATGTGAGTTTAGCAGAACAACTGGAAGAATCTGAAATGGTATTTGAAGTTTGGCATCAAATGGCACGAGGAATGAGTGGTGACCAGGTGATACGATCACGTGTAGAGGCCAGGTCTGGAAGGGAGAAGGATGTTCTACTTGGTGTGGGAAGGGTGCCACTTATTAAGCTTCTTGCTTATAAAACAGGAGTCAAAGGATGGTACCCTATACATTTACCTGGTGAAAGCAGCATCCATGATGCATCCCCTCATGGTGATGTTGACAAGGTTGTTGGAGGGTTGGAACTGAGCATCAGTTTCTCTGAAGCTGAGGACAGGGATCATGTCATTCACATGTCCAGAAGTGTCGGCTGGTCTCCACCGCCTGGGATAGATTGTGATGAGGACTGGCTGGACAAGGAGGATCTTTCCAAAAACAAACACTGGGAGTTTTGCTTGAAAATCAACAAGGCTTGGATTCCTTCATCAGAATTACATTCCTTTAATGCAACAGCAAAGAAACTTGATAAAAGTGTTAAGGCTTATGCAAGATACAAGCTCTACAACAAAGCTCCCATATGCTCGAGAGTATCATCGGTGAAAGATTCTGGTGATGGTAAACTGATCTGTGAGCTGAAACATTCCAAAGATGTTGTATTAGCAGCTTCATCCTCGCTTACTTGGCACATGAGAGAAGAGTGCTTAGAGATCCAGTTATGGCTCAGTAACAGGAGACATACTGCAGATAAGCACTCTAGGAAGAGAGACAGATTACTGGGGTCAGCCTTTGTAGATGTTTCATCATTGCTTGCTGGCCAGCAAAGGAAACATAGACAAATCAGTGGCTTGTACCCACTGTTCAGATCTGGTGCTAGTGATCTGTTTGGTGCATGTATCCATGTTCAGGCATCCCTTAACGTATGCTCTGAGGATAACAGTGACCACGAGCTTGACCTTGAACAGCATTTAAGCTCAGATGAATCTGTTGATGGTAGTTCTCCTGTTGAGGATCATGTTGTAGACAACAATACAGTAATCTGCATTCAGGATCACCCTCCATCAGTTAAACCAACACAACATGAAGTAAACAGACAGGTGCCAATCACTGCAGCTGATGACGACACTTTCATGGCACATGTTATCATTGAACAAGCACTTCACCTTCCTACTGTTCCAGGAGACAATGATACAAGATTAATGCCCAATGTGTATGTCTCTTACCAAACACTTGCCTCCATTCCCCCATCATCCACACCAGTTGTTATGTTATCATCCAGTCCTAGCTGGGAGTATCAGAAACTGGAGAGGATCAGTTATACCTCACTAAAATTGCAGGATCTTGTATTCAAAGTGTGGCACACCCCAGGAGCATATGACAAAGATCGTCACAGTACAGCAACAGAGACTGTTGAAGGAAGGGTAGACAGTTCCAATGAGGACCGTGTTATTGGATTTGTGTCATTTGATCTGTCGCCGCTGTTGGCTGGTATGAGGCAGGTGATTGGTTGGTACAATGTGACTGATTTCAATGGAGACAGCCAAGGACAGATCAAGCTTGGTGTTTCACCTGTGAATCCTGTGTCTCCACCACGATGCTTACCTGTTTCAAGAACAACACATGTCCATCCTCCAAAACAAGATGCTGCCTTAAACCCTTTCCTAATCAATCATGGTGCAGATGGCTCAGACGACAGATTCCAAATGGACGATCCTCTATCAACTCAGCGAGATGGACATCAACAGGAGCATCTCACTGGTATCAGGCCACACTCACATGGCGGCATTAGACTAGAAACAGAGGCACCACCAGTTTGTTCCACATCTCTCCTGTTTTCTCAGTTAAGGCATAACATGAATGAGCTAGATGCTCTTCAGCGAAATTTAAATGTCAAGTTACGATCAAGTACTACATGGAATGACGCTGGACACACTCAAGAACAGTCATCTGTCACTGTACCACTATATGGTGCTTTGCCCGGCATAGATGTCACTGCAGGAACATCATTAAGAACTTTGGAAACATTTAGAACTGAAACCACGGCTGTTGAAGGTCATGCGTTTGAGCACAAGTCACATAGAACTGAATTTGAAGAAACTGATCACAGGCATGAGGTGTTGCCTGTAAGTGGTAAAGAAACAAGAGTGGACCCTGATGATGGATACACACTGTCCTCTCGTCACTCACCTCTAGAAATGGAGCAAGCTCGTCACTACACTACTGAAAGAACTATTGGTGGTATGCTAGAGAAAGGTGACTCAAGTGGAGTTTTCCCTTTTATTAAAGACAAAAGGGAAAGTGTAGAACACGATGCAGTTGTAGACAGTTTCTTCAATGTAGAGAAACAAAGGTCTTCGCCTGAAGATCGACGGCCATCTGTCGATAGTGAGCTTAGCGTCAGTGATGTTTCAGGCGACCTTTCTGTAAGTGGTTATGTTCAGAACAACACAAAAAGCACACGGTTTGCTGATTTCAAAGACAGTTGGCTTAGCAGTGAAGAGGAAGATAACACAAATACGAGCCAGTCTGAAAAGCCTGGTTTGTCAACAGCTCCTTGTGCATTAAATGCACACAATGATACAGAGGAGGGCCTGAACAGTGCTACAGAGTCTTGCGTTCACCATCATGGAATAGACAATCATGCCAGTGACCGTGATGATGACGACAGTGCTGGTGATAATAATGATGACGGGAATTGTCACGTGATGCGGAGTCAAGTTGACGGAGAGCAATGTTTGGAAGACAGCATTGAAAACCATAATGTGGAAGCAGACTTTACAACTGGGACAACTGTTGTTGGCTCTGTTGTTGGTACTGATCATGAAATTGAACCTAATTCTCATGGTTCTTATAACAGTTTGCATTCAAGAGAACTGCCAAAGCAAGCTCCACTGTCTAGCTGTCCTACTTCGTATCAACAGACCAATGCTATGTTGCCGAATTTCTTTATGCCATCAGAACAACTAGAAGAATCTATGAGAGCGCTTAGATTGGGTTCCTCGACCAATAATTCCCATTCTAAACTGTTATCTCGTTCAAAATATTTGAAAAGTGATCATCGGACAAAACGAAATTTAACTGAGAAGTTTGCTAAAAGACAACCAGTTTACAAGGCAAGGAGAGACGAAAGACCTCCAATCTCCAATTCAGAGGTGGATCGAATAGCTAAAATTTTCAACTCTGGGAGTGTATCATAG

Transcript

OS493_019459-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4AC94	C2 domain-containing protein 3 OS=Homo sapiens OX=9606 GN=C2CD3 PE=1 SV=4
A0JM13	C2 domain-containing protein 3 OS=Xenopus tropicalis OX=8364 GN=c2cd3 PE=2 SV=2
Q52KB6	C2 domain-containing protein 3 OS=Mus musculus OX=10090 GN=C2cd3 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002665 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00168 all species →	C2	C2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21254 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005814 all species →	Cellular Component	centriole	Interproscan
GO:0034451 all species →	Cellular Component	centriolar satellite	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan
GO:0061511 all species →	Biological Process	centriole elongation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16751	C2CD3; C2 domain-containing protein 3	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_019459-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

20.6Max TPM

5.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.73	9.02
polyp at pH7 6	18	18	6.02	9.73
coral polyp · control treatment	16	16	5.87	20.60
coral polyp · oil and dispersant treatment	16	16	4.11	20.47
coral polyp · oil treatment	16	16	4.97	8.30
coral polyp · dispersant treatment	16	16	3.50	7.06
Polyp	10	10	7.04	9.37

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.02
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.57
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.45
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.02
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.98
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.85
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.57
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.32
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.10
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.24
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.22
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.11
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.09
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.90
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.89
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.54
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.47
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.73
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.75
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.70
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.08
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.82
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.81
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.39
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.01
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.89
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.59
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.55
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.50
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.31
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.24
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.21
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.62
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.62
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.58
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.60
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.34
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.08
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.55
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.11
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.89
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.40
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.36
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.20
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.80
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.39
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.70
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.07
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.06
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.78
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.47
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.28
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.88
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.79
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.36
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.66
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.65
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.52
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.51
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.34
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.17
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.88
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.60
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.47
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.30
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.58
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.35
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.00
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.64
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.46
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.14
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.53
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.49
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.10
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.07
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.76
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.71
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.56
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.42
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.39
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.06
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.57
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.76
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.62
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.52
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.03
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.28
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.75
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.61
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.53
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.49
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.18
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.54
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.98
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.37
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.75
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.40
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.26
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.11
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.72
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.23
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.52

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.