Gene detail

Detailed information of OS493_019589-T1 in Lophelia pertusa

Genomic Location: scaffold_69:447859...545662
NR annotation: KAJ7378898.1, hypothetical protein OS493_019589 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_019589-T1

ATGAAGCTGTTGGTAGATACTCCAGAAAAGGCATGTGTGCACTGGATAAGAAAGCAGTTCTTAAAAAGCAGCTTCAAATTTGATACCTTTTTTACTTCTCGCCATATCCCGTTAGCATCCTTCACATTGATACTGGAGATTCCTCTGCACCTAAAACTACTGTCCTCATTCCCAATCTTGCCAAAACAGTGGGCAGCTATCAGTCACTTCAAGGACTCCATACTTCAGGGGAGCCGTACTTTGTTAAAGGATGCCACTCAAACTGAAGAGATGCTTGCAGAGTCACTGTGTGCAATTCTTCTGTTAGAGGAGAGCTCACCTCGTCAGGTCTTTACTGAGTTTATCTTGGCAAGAAAGAATGCATTAAAAGAGATCTTTCACCCCAGTCAACATGCCACAAGTATCAAGTCTCAAGTTTGTGAAGTTGTACGAATCATTCGAACAAGTCTCTATCAAATACATGCCCTGTTCTATTGTGACGATGGAGGTGGAGAAAAGGAATTTAAAGATAATCCAGCACTTGTATTCAAAACCCTTGGTGACATTACGAAAAGAGAGACTTCAACAAACAGTGATGAGGAAGCTTTGGAGGCTTTGTTTGGTCCGGACTTTGATCTGGTAACCAGTGCAAGATTCCTTCCCAAGACTGTATTAGGCTACAGACCACATGTGAGGGCATTTCCATCTGTAATATCCAGAAAAAATATTTGTGACAACTGTACAGAATGGATTTCAATGTGTATTAAGGATGTAACCACTGGAGTAAACAATCTACTGAAATACATAGGCAGTCTGAAAGGCCTGGCCTCTATACGCGATGCTGTGTGGGACCTACTCAATGAGGTCACCACAGAGAAGGCAGAGTCCAGTGACCACACACTAGACTGGTCAAACTCTTTAGCTAAGGATATCTTGAAAGGTCTGTTTGATGCCACAGTGTCATCATGTAAGAACATGCTAATCAAATCACAAAATGACATCTCTGACCATAACACCCCTGCCACTGATCTCGGTGTACTCTGGGAAAGGGATATTGCCATGTATGTGTGGCAAGAGAGTGCAAATGATATTCCTAGAACCATGCAGGGATCACAGGAAAACAGTGTAGCACATCATGAGCAGGAAAGTGGACTTTCACTGAAGGCACGTGTCTGTACTCCTTCTATACAGAGATTGTGTAAAGTAGTTGATGACAAATTAGCAGCAACTCTTGAAGATGCCCAACACTTCATTTTGGATGTCCAAAAGGCTGAAGGCCCTGAGCTCAGCAAAAAAACTTCAGTGAGCAAAGTCTCTGACTTATGCTTTCTTGCCAGAAACAAGACAATCACCGACAAAACAGACCCATTTGATCGGTTTGGTGATTCACACCAAATCCAGTCCTTTCTTCAGGAAACCTGTTTTTCTGCATTTAGTCAATTGTTGCAGTATATTGATGACATAATAGAAAATCACAAGGACAAGTTATTGTTGAATTCAGAGGAAGTTCTTGCATCGAAATCACACTCATTGTTTGACACAGTCTGCATTGACAGAGTTCTGTTCCTTGGTCGGTTGTGTCACTCTTTCGCTGAACAGTGTCCCAGTATCAAGTTTGTCATGGAAGGAGGGGCAGCAGAGGGTAGAGGTCGAGGAACACCAAGAATGCCCAAGTCTTCCAGCTCAATAAGGAAAAAGGAAGACAACAGGATGGCTGAACTTGCTAATCTTTTCAAAGAGGGATACTTTGCGGCGTACAGGTTGTGGAAAGATTGGATCTCCATACTCTTTTTGTCTTCATTAGAACTGACATTAATTTATGGTGGCAAAAATGCGTTTTTGTTGTCAATGACTAACTGGGAAGCAGTAAAGATTAAAGAGGAAACAGAGGAGGGGAAGCTGGTAGAATCCATTATAAGAGTTCCTACCCAGGTTTCATCTCACATAACGTCTTTGCTGTTCAGTCTATGCCAAGAACTCAACAGAACTGGGGCACATGCCTTAGACAGGAAATTACTGCGCGAGCTTGTCACGAGCCTGTCACATGGAGTTATTTTAACGCACGAGAAATTAGTCCGCGAGCACAAGTCGAGTTTAACTCAAAACCATGCTCTACAGATAATGTTCGACTTGAGATTCATGACGTCCATCCTCATAGGGCGGAGTGACGACGAGAGTTCTGAGGTTTCAAGTCGTCTTGAACAAGTTGTGGACACTTTGGAAGGCTGTGTCGATCCATTTGATTTGGATGTGTTTTCTCCTCACATTGCAACAAACCTTACTAAACAGCTTCAGAGATGCGGGGTTTTATTTGGTGTCTTATCTAGTCTGGACAAGCATTCTACTCATTCCTTTGGTGTAACTCAACGGCCTTCCCCAGGCTCTCATGACCAACACAACGTTATGCCGTTGGCTCCCAATCCACCACGATTCACCCTGTTGCCTCTCAGTTCTCATTCAAGCGCGGGACTTGGGTACCAAGCAGGAAGTCATGATCAGGGGTCTTTGAACCAACAAGAAGATGCAAAGGGTGTCATTCCTCGAACAGCATTCTTCAAGCATCACCAGTTTTTTAACACAAACTTCGACATATGTCAAGGGATAAAAGCAACGTGA

Transcript

OS493_019589-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Z160	Conserved oligomeric Golgi complex subunit 1 OS=Mus musculus OX=10090 GN=Cog1 PE=1 SV=3
Q8WTW3	Conserved oligomeric Golgi complex subunit 1 OS=Homo sapiens OX=9606 GN=COG1 PE=1 SV=1
Q9VGC3	Conserved oligomeric Golgi complex subunit 1 OS=Drosophila melanogaster OX=7227 GN=Cog1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004367 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_019589-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR033370 all species →	Family	Conserved oligomeric Golgi complex subunit 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR31658 all species →	CONSERVED OLIGOMERIC GOLGI COMPLEX SUBUNIT 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005794 all species →	Cellular Component	Golgi apparatus	Interproscan
GO:0006891 all species →	Biological Process	intra-Golgi vesicle-mediated transport	Interproscan
GO:0017119 all species →	Cellular Component	Golgi transport complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_019589-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_019589-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

55.7Max TPM

25.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	29.81	52.38
polyp at pH7 6	18	18	29.70	54.26
coral polyp · control treatment	16	16	29.09	55.73
coral polyp · oil and dispersant treatment	16	16	26.14	41.83
coral polyp · oil treatment	16	16	27.06	40.23
coral polyp · dispersant treatment	16	16	21.11	37.23
Polyp	10	10	11.17	16.29

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.38
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.65
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.99
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.68
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.72
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.17
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.34
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.98
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.38
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.25
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.47
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.17
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.45
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.69
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.38
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.39
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.79
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.59
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.26
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.51
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.22
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.11
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.20
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.36
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.78
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.81
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.07
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.91
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.69
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.72
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.57
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.56
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.36
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.03
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.84
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.49
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.73
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.19
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.79
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.27
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.13
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.44
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.10
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.93
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.19
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.37
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.89
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.67
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.69
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.60
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.83
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.69
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.83
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.40
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.88
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.57
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.54
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.99
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.96
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.80
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.33
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.85
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.27
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.72
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.18
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.07
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.11
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.78
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.23
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.80
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.77
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.85
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.87
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.37
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.16
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.08
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.76
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.54
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.50
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.85
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.55
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.85
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.65
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.72
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.82
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.78
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.64
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.92
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.58
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.42
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.94
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.93
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.70
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.97
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.27
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.75
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.46
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.29
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	15.19
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.33
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.71
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.38
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.87
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.59
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.62
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.67

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.