Gene detail

Detailed information of OS493_020466-T1 in Lophelia pertusa

Genomic Location: scaffold_75:1192375...1206723
NR annotation: KAJ7378864.1, hypothetical protein OS493_020466 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_020466-T1

ATGGATTTTCCCGATTTTACAAAACAAGGAGTCGTGCAGGCTAGTGGAGTTGAATTTCCTCGGTCATCACTTCATACACCAACTAGTTCATCAAGGTGGAAAGGGCATGAGCCAAGAGCTTGGAAAGAAGTGTTAGAAGATCCTCGAGAATGCAAGAATACCATTCTGCTGTCAGAACCTGGCCAAAGAGTTGTCAGGGCAATAAGAGAGATTTGTGGAGCACGTCAAGGCATGACTAGTCAATGCACACAACAGCAAGCTTCAGAATATTACCTCCAAGAATCACAGACTGCACCGAGGAGGCAGCTCTGTTTTACAGAAGATCACAAACCTAACCAGGAAAGAAACGATTCACAGAAGCTAAGCTCGGCACCGCCTTGTGGTATACAGCAAAGGTTACAGGCAAATGCCGTAACACCTAGAAATGTGTCTTCACATCCGTCTGAAGAAGAAGAATCACCTTACTTCGCTAAAACAGGTGAGAGTTCAAACAAGAGGAAAGCACAGAGTCCTATCACCAATTACTTCAAAGAAAGAAAAGCCGTTAGTCAAGTAAACGAGGTCAAGAAAGCCAAACCAACAAACGCAGACGCTCCACAAAAAGAACATGTCGACAAGAATCAAAATGGAGTCTCCTCTATGAATTCAAGCCAAAGAGAGGCGTTTGAACAGAACCTTAAATCAGCAGAAGAGGTCGCTTGTACTGTGGTGTATGAAGACGGATGGTCACTGTTAAGACCGAAGAAACAAAAAACGAAGAAACAAACAGAAGACGTCGCTAACAAAAAGGTTGCTAGGCTGGTTGTAGCATTACCCTGGTCTGAGATGACATCAAATACCACAGATTCTGCACAACGCCGTAAAAATCGACTAATGTTCGTGGAAATACCTCTTGATACAGCGGACGATACTCTAGGAACGTGGTGCAGGCAAGTGATTGATGATCTAATGACATCAACATCGACAAGAAAAATCTGTTTTGGTGCACAGAAAATGGTTCGGTATCTTATGGAGACGACACATTATGATATCAGAAAAGTCTGTCTCAACTGGCGTCTTCTTGATCCTAAAATAGCTGCTTGGCTACTGAACCCGGACCACCCTCCTCAGACCTTTGCTGACGTTCTTACGTCTGTCCAGCTCCACTTTCCAGAGTGTGGTGAAATGGATGATACTATGATATGTCAGGATGTTGCGATGCTTGGACCTCTTATGTTGAAACAACATAGCAAGCTAAAGACACTATCACTTTGGGACTTGTTTATCAACATAGAGACTCCACTTTGCTCGATGTTGGCAGTTATGGAAACTCAAGGAATTGGTATCAACTCTCAAGTCTTGATTGAAGCCAGCAATACTCTTAAGATGAAAATTCAAAAGGTCGAAGCAGAAGCCCATAAGGCTGCAGGACATCCCTTTCTTATCAACAGTCCTCAGCAGTTAAGAGAGGTGTTGTTTGAAGAGCTGCGACTTGACCAAAAGTGCAAGAAGAAGCTAGCAAGAACTTCAATCAAGAACCACAAGTCCACCTCAGAAGCTGTGTTACTTCACCTGCAAGAGTTTCACCCTTTGCCAAAACTTGTTCTGCAGTACAGACATCTAGTAAAACTGAAGTCAACGTATTTTGATGGAATTCTTTCTCATGTCAATGGGGGAGTTCTGTTAACAAGTTGGGACCAAACGGCCGCGGCCACTGGGCGACTTACTTCAGCAAATCCAAACCTCCAGGCAATCCCAAAACAGGTCATAGAAGTGTCTGGAATCAAGAAACAGCTGATCGTAGGCAAACCAGAAGAGGTGGTAACCATTTATGCACGGGATGCTTACAGAAGTAGAGAAGGCTGGTTATTACTTGCAGCAGATTTCCAGTCCATTGAGCTCCGTTTACTGTCTCACCTGTCCGAGGACCCGTCGCTGATACACATCTTCAATGACAAACAATGTGCAGACGTATTCACAACACTTGCTTCACAATGGTTGGGCAAGAGCTGTGATGAAGTCCAGTTTCACGAGAGAGAAAGAACCAAACGAATCGTCTATTCTGTCAATCTACGGTGTTGTATTGAAAGTTGTCACAGAAATGGTTACGTGTCCTCCATTCTGAATAGAAGGCGTTGGCTTCCACATATCAAGTCGTATGATTTTACCCAACGATCACAGGCTGAACGACAGGCTGTCAATTTTATCGTGCAGGGTTCAGCCGCGGACATATGTAAAGCAGCGATGATTCAGGTCATAAGTACCATAAGCGAGGACACGTCCATACACGCAAGATTGCTGTTACAAATACATGATGAACTTCTTTTGGAAGTTCCTGAAAATGAAATCATGAAAGTAACAGCCACGGTCAAATCGATTATGGAGTCTACTGAGAAACTCTGTGGCGGAAAAGTCAAGCTAAAGGTGCCACTTCCTGTATCTATCAGCATTGGACAGACATGGGGACACATGGAGACCTGCACTGCATGA

Transcript

OS493_020466-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7TQ07	DNA polymerase nu OS=Mus musculus OX=10090 GN=Poln PE=2 SV=2
Q7Z5Q5	DNA polymerase nu OS=Homo sapiens OX=9606 GN=POLN PE=1 SV=2
P30313	DNA polymerase I, thermostable OS=Thermus thermophilus OX=274 GN=polA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008336 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF18049 all species →	DNA_pol_P_Exo	DNA polymerase nu pseudo-exo	Domain	Interproscan
PF00476 all species →	DNA_pol_A	DNA polymerase family A	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002298 all species →	Family	DNA polymerase A	Interproscan
IPR001098 all species →	Domain	DNA-directed DNA polymerase, family A, palm domain	Interproscan
IPR043502 all species →	Homologous_superfamily	DNA/RNA polymerase superfamily	Interproscan
IPR040940 all species →	Domain	DNA polymerase nu, pseudo-exo domain	Interproscan
IPR036397 all species →	Homologous_superfamily	Ribonuclease H superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10133 all species →	DNA POLYMERASE I	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003887 all species →	Molecular Function	DNA-directed DNA polymerase activity	Interproscan
GO:0006261 all species →	Biological Process	DNA-templated DNA replication	Interproscan
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan
GO:0097681 all species →	Biological Process	double-strand break repair via alternative nonhomologous end joining	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16618	POLN; DNA polymerase nu	EC:2.7.7.7	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_020466-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

61TPM > 0

7Conditions

101.8Max TPM

2.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	1	0.02	0.38
polyp at pH7 6	18	1	0.01	0.12
coral polyp · control treatment	16	11	7.46	101.85
coral polyp · oil and dispersant treatment	16	14	6.10	81.29
coral polyp · oil treatment	16	14	1.75	8.22
coral polyp · dispersant treatment	16	14	0.57	2.53
Polyp	10	6	0.44	1.68

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.38
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.12
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	101.85
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.07
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.05
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.24
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.48
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.96
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.28
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.08
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.08
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.04
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	81.29
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.54
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.97
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.73
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.60
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.46
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.01
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.85
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.47
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.36
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.12
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.08
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.07
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.06
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.22
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.78
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.44
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.21
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.49
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.77
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.59
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.51
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.24
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.22
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.18
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.13
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.11
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.53
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.34
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.22
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.86
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.85
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.73
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.61
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.29
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.22
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.16
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.12
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.08
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.08
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.05
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.68
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.15
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.60
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.53
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.10
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.