Gene detail

Detailed information of OS493_020603-T1 in Lophelia pertusa

Genomic Location: scaffold_76:1145298...1152038
NR annotation: KAJ7372174.1, carbohydrate binding [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_020603-T1

ATGGCTTTCTTTTCTCAACAGCAGAAAATGATAATTTTGTTCTTCTTTGTGACCTGTTTCTGTCTGGGCGCAGCCTTCGAGTGCAAGTTTGACGGAGAAGTGAAGGATAAAGACAAACTACAGGTCCATCTTGTCCCTCATACACATGACGACGTAGGCTGGTTGAAAACTGTGGACGAATATTATTATGGAGCAAATAATTCCATCCAGCACGCTGGTGTTCAGTACATTTTAGACTCTGTTATTCCCCAGTTAACTGCAGACCCGTCAAAGCGATTTATTTACGTGGAGATTGCGTTTTTCGAGCGCTGGTGGAACGAACAAGATGAAGCCATGCGAACGGAAGTAAAGAAACTTGTTGCAGAGAAAAGGCTGGAGTTTATAAACGCTGGATGGTGCATGAACGACGAGGCTGCCACACATTACAATGCAATCATTGATCAAATGACTTATGGACTGAACTTTGTGGAGGAGACATTTGGATCAGACGCAAGACCACGGATAGCCTGGCATATTGATCCGTTTGGCCACTCGTCAGAACAAGCTTCAATCTTTGCTCAAATGTCATTTGATGGATTTTTCTTGGGTCGAATCGACTACGATGATAAAAAGCTTCGCCTCAAGCAGCAGCGAATGGAGCTTGTTTGGAGAGGAAGCAGAAATCTTGCAAAATATTCTGATATTTTTACAGGGGTGCTATACAACGGCTATGCCGCTCCACCTGGATTCTGTTACGACCAGTCATGCAGAGACGCGCCAATACAAGATGACCCGAACCTCTTTGATTTGAACGTCAAAGAAACCGTGGAAAGATTCGTGAACGCAACATGCGCACAAGCATCGCAGTACAAAACCAATCACATCATGCTGACCATGGGTGAAGATTTCCAGTACGAGAATGCAAACACGTGGTACAAAAATTTGGACAAGCTCATCAGATATGTAAAGGAAGATGGCCGTGTGAATGCATTCTACTCTACACCAACCACCTACTTAGATGCTCTGCACGATGCAAACCAGACATGGGAATTGAAGACTGATGATTTCTTTCCTTATGCTGACTGTCCACATTGTTACTGGACGGGCTATTTCACCAGCCGCCCAGCACTCAAGCGATATGTCAGATACAACAACAATTTGCTTCAGGTCTGTAAGCAACTGGAGTTGATCAGTGGTCCTCCAATGAAAAATGGTCCAACTTCTGATACTCTGCGCAGAGCAATGGGTGTGGCCCAACACCATGATGCTGTCAGTGGTACATCAAAGCAGCATGTGGCTGATGACTATGCCAAGCGACTTGCTATTGGTGCTGTAGAATGCCAGATGTTGGTTGGTGATGTGCTCGGCAAATTCCTGGTGAAAAGCGCTGAAACCAAACCTCCTGCTTTGACATTTTGCGACCACCTCAACATCAGCGTCTGTCCCGTGACTGAACAGAGCAAGGCCTTCACTGTGACAGTTTATAATCCCATTGCCCGAGACGTCAATGCTGTTGTTCGCCTTCCAGTTGCCATCGCCGCAATGGCTGTGTTTAGTCCGCAAGGCACCCCAGTGGAAAGCCAAGTGCTGCCCATTTCCAACGCTACGAAACAGCTGCGTAAAGATCAGAACCAGAACCAGAGCCAATCATCTTTTGAGCTTCTTTTCAACGCCAAAGTTCCAGCTCTTGGGTTTGCAACTTTCTTCGTGAACTCGACCAAGTCGCGGTCAAAACTACAGAAGAAATTTTTCCGCCCCGCCCCTGAGCACGCGTTCAAAGATTCCAGTGAAGTCTCCATCGAAAACGAATTCATTAAACTTTCCTTCTCGCAAGACACCGGTCATTTAACAAGCATGACAGACTTGAGTTCCAAAATCACTACAGCAGTAAACCAAGCATTTTACTGGTACAATGGTAGCATAATAGAAGAACAGCCATCCGGCGCGTACATATTCAGACCCAACAGTAGCCATGTCAATCTTATCTCCACGGGCGGCAAGGTAGAGACCTTCAAAGGTCCTATGGTGCAGGAGGTACGCCAGGTAGTATCTCCTTACATCAGCCAGGTGGTCAGGCTGTACACTGGTCAGAAGCATGCCGAGTTTGAGTACACTGTGGGGCCGATACCCGTGGGAGATCACTGGGGCAAGGAAGTGATCACCCGCTTTGACACGGATATCAAGTCTAATCAACTCTTCTACACCGATGCCAATGGCAGGGAGATGCAGGAACGCAAACGAGATTACCGACCGACTTGGACACTGGACAACACCGAGCCAGTTGCTGGTAATTATTACCCGGTGAACAGTCGAATGTACATCAAGGACAGCGCTAAACAGCTGACAGTCCTGACTGACAGGTCCCTGGGTGGGGCCAGTCTGAAAGACGGCTCGTTGGAGATCATGCTGCACCGGCGGCTTCTCAAAGATGACAAGAGAGGCGTGGCTGAACCGCTCAACGAGACGGGAATCCTCGGTAAAGGTTTGATTGTCCGCGGGAAGCTGTGTGTTATTCTGGCGCCGCCAAAGTCGTCTGCCGCTCTTCATCGCGAACTCGGCGAAAAACTCCTTCTGGAACCCGTGCTGACCTTTGCGCCTAACAGCCTCACTTTCAAGAAGTGGACAAGCCAGTTTAACTCGTTGCATAGCGGTCTCACCCGTGAACTCCCCGCTAATGTTCACTTGTTGACACTGGAGACGATGAGCGACACCGCGTTGATCCGCGTGGAGCATCAGTACGAGGCTGGCGAGGATCCCAAGCTCTCACAACCCGTCAACATTTCACTGGCGGGGCTTTTCAACGATTTTGACATCGAATCCATGACGGAAATGAACTTGGCTGCCAATCAGTTACTGGCGGACAAACAGCCTCTATACTGGAATATCAAAACTGGGAAGAATATAGAAGTAAACAAGAAGAAGAGGAAGGCATCTCGAGTGGCCTCTGATTTGAACGTGGCACTCACTCCAATGCAGATTCGTACATTCAAAGCTGTCATCAAGCGTCACGGAACTTTCCGATTTAATAAGCACTAA

Transcript

OS493_020603-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q60HE9	Lysosomal alpha-mannosidase OS=Macaca fascicularis OX=9541 GN=MAN2B1 PE=2 SV=1
O00754	Lysosomal alpha-mannosidase OS=Homo sapiens OX=9606 GN=MAN2B1 PE=1 SV=3
Q8VHC8	Lysosomal alpha-mannosidase OS=Cavia porcellus OX=10141 GN=MAN2B1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002052 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07748 all species →	Glyco_hydro_38C	Glycosyl hydrolases family 38 C-terminal domain	Domain	Interproscan
PF09261 all species →	Alpha-mann_mid	Alpha mannosidase middle domain	Domain	Interproscan
PF21260 all species →	Laman-like_dom	Lysosomal alpha-mannosidase-like, central domain	Domain	Interproscan
PF01074 all species →	Glyco_hydro_38N	Glycosyl hydrolases family 38 N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015341 all species →	Domain	Glycoside hydrolase family 38, central domain	Interproscan
IPR037094 all species →	Homologous_superfamily	Glycoside hydrolase family 38, central domain superfamily	Interproscan
IPR013780 all species →	Homologous_superfamily	Glycosyl hydrolase, all-beta	Interproscan
IPR050843 all species →	Family	Glycosyl Hydrolase Family 38	Interproscan
IPR011682 all species →	Domain	Glycosyl hydrolase family 38, C-terminal	Interproscan
IPR011013 all species →	Homologous_superfamily	Galactose mutarotase-like domain superfamily	Interproscan
IPR027291 all species →	Homologous_superfamily	Glycoside hydrolase 38, N-terminal domain superfamily	Interproscan
IPR048534 all species →	Domain	Lysosomal alpha-mannosidase-like, central domain	Interproscan
IPR011330 all species →	Homologous_superfamily	Glycoside hydrolase/deacetylase, beta/alpha-barrel	Interproscan
IPR028995 all species →	Homologous_superfamily	Glycoside hydrolase families 57/38, central domain superfamily	Interproscan
IPR000602 all species →	Domain	Glycoside hydrolase family 38, N-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11607 all species →	ALPHA-MANNOSIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004559 all species →	Molecular Function	alpha-mannosidase activity	Interproscan
GO:0006013 all species →	Biological Process	mannose metabolic process	Interproscan
GO:0005764 all species →	Cellular Component	lysosome	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12311	MAN2B1, LAMAN; lysosomal alpha-mannosidase	EC:3.2.1.24	Lysosome	ko04142	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_020603-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

42.7Max TPM

17.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.43	18.76
polyp at pH7 6	18	18	13.10	19.55
coral polyp · control treatment	16	16	21.47	36.72
coral polyp · oil and dispersant treatment	16	16	26.48	42.69
coral polyp · oil treatment	16	16	17.84	29.43
coral polyp · dispersant treatment	16	16	16.56	32.40
Polyp	10	10	8.28	12.27

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.76
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.08
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.05
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.58
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.14
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.36
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.34
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.77
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.67
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.80
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.63
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.23
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.69
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.38
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.27
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.80
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.47
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.78
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.55
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.84
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.61
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.59
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.90
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.09
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.05
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.95
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.34
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.25
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.72
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.23
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.27
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.97
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.64
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.90
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.54
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.72
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.17
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.43
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.69
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.12
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.07
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.93
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.50
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.30
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.67
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.61
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.39
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.02
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.48
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.36
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.69
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.95
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.99
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.83
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.08
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.97
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.60
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.39
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.81
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.85
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.79
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.59
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.55
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.01
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.42
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.43
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.12
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.65
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.42
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.01
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.11
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.01
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.27
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.35
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.41
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.44
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.84
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.89
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.46
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.24
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.40
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.95
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.06
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.96
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.03
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.86
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.40
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.87
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.32
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.74
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.87
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.70
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.40
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.02
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.78
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.65
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.27
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.52
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.51
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.91
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.36
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.82
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.70
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.15
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.28
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.31

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.