Gene detail

Detailed information of OS493_020608-T1 in Lophelia pertusa

Genomic Location: scaffold_76:1189913...1209048
NR annotation: KAJ7372179.1, hypothetical protein OS493_020608 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_020608-T1

ATGTCGGCGAAAGCTATCTACGAAACCGACGGAAAGTCACTAATTGCAAAATGCTTTCAAAACTCTTGCTACGTCAAGAACAAATTTGCTGTTATTGTACATGACACAAATTGGGACGAAGTTGTTCGGGAAAATCCATGGATTGCAAGCGAGAAACTTGTTGTAAAGCCAGATCAGCTTATTAAGCGCCGAGGCAAGCTGGGCCTCTTAAAGGTTAATGCCGATTTACCAGAAGCCAAGAAGTGGATTGACGAGAGAATGGGCAAAGATATACAGGTTGGAGCTGCAAGTGGACCACTAAAAAGATTCATCATTGAACCATTTGTTCCACACAAACAGAATGAAGAATTTTATGTGTGCATCTACGCCCAGCGACACTGTGACACAATTTTATTTCATCACGAGGGTGGAGTTGAAATTGGAGATGTCGACAGCAAGGCTGTTAAACTTGAAGTTGGCCTTGAAGATAAAATCACAATTGACTTGGTTGAGAAAAAACTTATGCAAAATGTTCCACAACAAAAGAAAAAATTGCTTGCTACATTTATCCATGACTTGTTTCAACTTTACACTAGCCTGTACTTCACTTACCTGGAAATAAATCCTCTTGTGGTTGTGGGTGAGTCAGTTCACGTTCTTGATCTTGCTGCCAAGTTGGATCAAACTGCGGAGTTCATATGTAAAACAAAATGGGGAGATATTGACTTCCCACCTCCGTTTGGCAGAGAGGCATATCCCGAGGAAGCATACATTGCTGAACTAGATGCCAAAAGTGGAGCTTCTCTCAAACTGACGATCCTGAACAGTAAAGGTCGCATATGGACCATGGTGGCTGGAGGTGGAGCATCCGTAGTGTACAGCGACACTGTGTGTGACTTGGGTGGTGCCTCAGAGCTAGCAAATTACGGCGAGTACTCAGGTGCTCCATCAGAATCACAGACGTATGAATACGCCAAGACAATTCTCAAGCTTATGACTCAGGGTCCACCAAGACCTGACGGCAAGATTCTTATCATTGGTGGAGGTATTGCTAACTTCACCAATGTGTCGGCAACATTCAAGGGCATAGTGAAAGCTCTGCAAGAATATCAGAAGAAGCTCTTGGAACACAAGGTACAGATATTTGTACGAAGAGGAGGACCAAACTACCAAGAGGGTCTCCGAGTCATGAGGGAAGTAGGTGCCAGTTTAGGTCTGTCCATGCATGTGTTTGGAACAGAGACGCACATGACAGCTATTGTTGGCATGGCTCTGGGAAAGAGAGAGCTTCCTAAAGATGTTGGCTTCGACTCGAATGCAGCAGCAAACATGTTCTTTACAGCTCAGAACAAGGGTTCTGCGAGTACTGGTAAACACACGGTGTGCAGGTCAGCCAGTTCGGAGAAAAAAACGGACAAGAAACCATCACCAGAGCAACACAGCAAGGCTACAGGAGGCAAGAAGACGGCTTTATTTACTAGTGAGACAAGAACAATCATCTGGGGCCTGCAAGCCAGAGCTGTCCAGGGTATGTTAGATTTTGATTATGTGTGTGAGAGAAATAGACCATCAGTGGCCGCCATGGTTTACCCATTCAGTGGAAATCACCGTCAAAAGTTTTACTATGGACACAAAGAAATCATGATTCCAGTGTACAAAGAGATGTCTGAAGCCATGAACAAACATTCAGATGCCGATGTCATGATCAACTTTGCGTCTCTTCGCTCAGCTTACGATGCTACTATGGAAGCCATGCAGTTTCCACAGATTCGCACGATCGCCATAATCGCTGAAGGAATTCCCGAGGCCAAGACAAGACAACTAAACCGCAAAGCTAAGGACCTTGGAGTGACCATTATCGGTCCAGCAACAGTTGGAGGTATCAAGCCCGGCTGTTTTAAGATCGGTAATACCGGCGGTATGTTGGACAACATTTTGGCGTCGAAGCTTTATCGACCAGGAAGCGTTGCATACGTGTCTCGTTCTGGCGGCATGTCCAATGAACTCAACAACATCATCTCGCGGACTACAGATGGCGTGTACGAGGGCGTCGCTATTGGCGGAGACAGATATCCTGGTACGACGTTCATGGATCACGTGATCAGATATCAAGAAAACCCGGAAGTCAAAATGATAGTGGTCCTTGGAGAGGTTGGTGGTACCGAGGAATACAATATTTGCGAGGCCATTAAGAACGGCACGGTTACAAAGCCTCTCGTGGTTTGGTGTATTGGGACATGCGCAGGAATGTTCACATCAGAGGTGCAGTTTGGTCACGCTGGAGCAAGTGCTCATGGAGACAACGAAACAGCTGTCGCCAAGAACAACGCTCTGAAAGAGGCCGGTGCTTATGTACCAAGCAGCTTTGATTCTCTGTTTGATATGATCAAGGACGTTTATGAAGTGCTCGTGAAGGATGGGACGATTGTTCCTAAAGCGGAGAAGAACCCACCAACAGTTCCTATGGATTACTCGTGGGCGCAGGAGCTTGGTTTAATCCGCAAACCGTCTTCGTTTATGTCGAGTATCTGTGACGAGAGAGGAGCAGAACTGTTGTACGCTGGTATGCCCATTACAGAAGTCTTCAAGGAAGACATCGGTGTTGGAGGAGTCCTGGGTCTGTTGTGGTTCCAGAGAAAATTACCCCAGTACGCAAGTGAATTTATTGAGATGTGCCTCATGATAACCGCTGATCACGGACCAGCCGTTTCCGGTGCACATAACACAATCGTGACAGCAAGAGCTGGCAAGGACCTCATATCTTCCCTGGTGTCTGGTCTCCTCACAATCGGCGACAGATTCGGCGGAGCGTTGGACGCGGCTGCTCGAGTGTTCTCTGAAGGTGTAGACAGTGGACAGGCGCCCATGGAATTTGTGAACGAAATGAGAAAGAAAGGACAACTCATCATGGGCATTGGACATCGAGTCAAATCTCTAAACAATCCCGACATGCGTGTAGTGATTCTGAAAGAATTTGTGAAGAATAATTTTCCCTCCACTCCAATCATGGACTATGCTATTGAAGTCGAGAAGATCACCACCTCCAAGAAACCAAATCTCATCCTCAATGTAGACGGTTGTATCGGCGCCGCATTTGTAGACCTACTGCGTCATTGTGGAGCTTTCACGAGAGAGGAAGCTGACGAGTTTGTACAGATTGGAGCGCTTAATGGATTGTTTGTCTTAGGAAGATCGATTGGTTTTATTGGTCATTACTTGGACCAGAAGCGTTTAAAGATGGGCTTGTACCGTCATCCTTGGGACGACATCACCTACATCATGCCAGACCATCTTAACGACCTCCGCCCGGCCAGCTTTGAATAG

Transcript

OS493_020608-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P53396	ATP-citrate synthase OS=Homo sapiens OX=9606 GN=ACLY PE=1 SV=3
Q91V92	ATP-citrate synthase OS=Mus musculus OX=10090 GN=Acly PE=1 SV=1
Q32PF2	ATP-citrate synthase OS=Bos taurus OX=9913 GN=ACLY PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005064 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16114 all species →	Citrate_bind	ATP citrate lyase citrate-binding	Domain	Interproscan
PF02629 all species →	CoA_binding	CoA binding domain	Domain	Interproscan
PF00549 all species →	Ligase_CoA	CoA-ligase	Domain	Interproscan
PF08442 all species →	ATP-grasp_2	ATP-grasp domain	Domain	Interproscan
PF00285 all species →	Citrate_synt	Citrate synthase, C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016102 all species →	Homologous_superfamily	Succinyl-CoA synthetase-like	Interproscan
IPR014608 all species →	Family	ATP-citrate synthase	Interproscan
IPR032263 all species →	Domain	ATP-citrate synthase, citrate-binding domain	Interproscan
IPR036969 all species →	Homologous_superfamily	Citrate synthase superfamily	Interproscan
IPR003781 all species →	Domain	CoA-binding	Interproscan
IPR017866 all species →	Conserved_site	Succinyl-CoA synthetase, beta subunit, conserved site	Interproscan
IPR005811 all species →	Domain	ATP-citrate synthase/succinyl-CoA ligase, C-terminal domain	Interproscan
IPR016142 all species →	Homologous_superfamily	Citrate synthase-like, large alpha subdomain	Interproscan
IPR017440 all species →	Active_site	ATP-citrate lyase/succinyl-CoA ligase, active site	Interproscan
IPR033847 all species →	Conserved_site	ATP-citrate lyase/succinyl-CoA ligase, conserved site	Interproscan
IPR013650 all species →	Domain	ATP-grasp fold, succinyl-CoA synthetase-type	Interproscan
IPR002020 all species →	Family	Citrate synthase	Interproscan
IPR016143 all species →	Homologous_superfamily	Citrate synthase-like, small alpha subdomain	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23118 all species →	ATP-CITRATE SYNTHASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003878 all species →	Molecular Function	ATP citrate synthase activity	Interproscan
GO:0006085 all species →	Biological Process	acetyl-CoA biosynthetic process	Interproscan
GO:0006101 all species →	Biological Process	citrate metabolic process	Interproscan
GO:0046912 all species →	Molecular Function	acyltransferase activity, acyl groups converted into alkyl on transfer	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006633 all species →	Biological Process	fatty acid biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01648	ACLY; ATP citrate (pro-S)-lyase	EC:2.3.3.8	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_020608-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

76.7Max TPM

44.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	55.09	65.99
polyp at pH7 6	18	18	56.65	76.68
coral polyp · control treatment	16	16	43.35	51.10
coral polyp · oil and dispersant treatment	16	16	34.70	50.11
coral polyp · oil treatment	16	16	41.65	56.74
coral polyp · dispersant treatment	16	16	38.37	56.12
Polyp	10	10	31.24	51.16

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.99
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.43
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.19
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.68
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.18
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	58.87
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.34
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.54
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.46
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.32
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.79
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.38
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.32
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.98
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.33
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.73
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.45
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.68
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	76.68
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	75.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.58
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.38
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	63.99
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	63.02
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.66
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.58
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.54
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.17
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.24
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.39
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.28
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.96
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.05
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.30
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.08
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.10
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.16
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.53
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.99
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.74
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.03
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.58
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.64
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.32
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.10
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.90
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.35
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.78
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.25
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.15
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.11
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.59
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.33
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.42
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.74
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.36
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.31
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.52
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.09
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.85
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.08
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.35
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.01
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.76
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.62
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.03
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.74
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.88
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.33
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.91
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.86
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.44
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.90
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.76
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.45
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.66
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.12
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.73
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.26
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.98
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.12
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.58
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.99
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.91
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.20
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.02
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.49
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.13
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.49
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.92
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.99
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.38
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.07
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.41
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.43
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	51.16
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	41.88
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	36.40
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	32.49
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	32.39
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	26.66
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	25.41
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	24.08
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	22.09
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	19.80

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.